Previous Contig 004174:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS097F03Sequence638004174 (5)
JMFS103B03Sequence575004174 (5)
JMFS118F10Sequence620004174 (5)
JMFS156F12Sequence594004174 (5)
JMSF005P19Sequence264004174 (5)152004758 (6)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS118F10+ GCTCAATATATGGTTGATAGTGGCTTCTTAAACAGC
JMFS097F03+ TGATTTTCAGCTCAATATATGGTTGATAGTGGCTTCTTAAACAGC
                      ____________________________________________________________
consensus TGATTTTCAGCTCAATATATGGTTGATAGTGGCTTCTTAAACAGC
 
. : . : . : . : . : . :
JMFS118F10+ AAAACAAGCTCTCCTCACATATACTAGACAACGTTGCTGCTGATTCTTCAGTCAAGGGAA
JMFS103B03+ ATATACTAGACAACGTTGCTGCTGATTCTTCAGTCAAGGGAA
JMFS097F03+ AAAACAAGCTCTCCTCACATATACTAGACAACGTTGCTGCTGATTCTTCAGTCAAGGGAA
JMFS156F12+ AGCTCTCCTCACATATACTAGACAACGTTGCTGCTGATTCTTCAGTCAAGGGAA
                      ____________________________________________________________
consensus AAAACAAGCTCTCCTCACATATACTAGACAACGTTGCTGCTGATTCTTCAGTCAAGGGAA
 
. : . : . : . : . : . :
JMFS118F10+ CCAGATCACTCCTAACAGGTGCCTTACAATGAGAAGAATATGCATCTAAGAAGTTACAAC
JMFS103B03+ CCAGATCACTCCTAACAGGTGCCTTACAATGAGAAGAATATGCATCTAAGAAGTTACAAC
JMFS097F03+ CCAGATCACTCCTAACAGGTGCCTTACAATGAGAAGAATATGCATCTAAGAAGTTACAAC
JMFS156F12+ CCAGATCACTCCTAACAGGTGCCTTACAATGAGAAGAATATGCATCTAAGAAGTTACAAC
                      ____________________________________________________________
consensus CCAGATCACTCCTAACAGGTGCCTTACAATGAGAAGAATATGCATCTAAGAAGTTACAAC
 
. : . : . : . : . : . :
JMFS118F10+ ACTAAACAAGAGTGTATGCAGTCTATTCTTGATGATGTTTAAAAACATCATTTATTTGCT
JMFS103B03+ ACTAAACAAGAGTGTATGCAGTCTATTCTTGATGATGTTTAAAAACATCATTTATTTGCT
JMFS097F03+ ACTAAACAAGAGTGTATGCAGTCTATTCTTGATGATGTTTAAAAACATCATTTATTTGCT
JMFS156F12+ ACTAAACAAGAGTGTATGCAGTCTATTCTTGATGATGTTTAAAAACATCATTTATTTGCT
                      ____________________________________________________________
consensus ACTAAACAAGAGTGTATGCAGTCTATTCTTGATGATGTTTAAAAACATCATTTATTTGCT
 
. : . : . : . : . : . :
JMFS118F10+ CTCAATTTTTTTTTTTCCTCAAACGATGATGAACTCAACACTTAACAGTAGAATCACAAC
JMFS103B03+ CTCAATTTTTTTTTTTCCTCAAACGATGATGAACTCAACACTTAACAGTAGAATCACAAC
JMFS097F03+ CTCAATTTTTTTTTTTCCTCAAACGATGATGAACTCAACACTTAACAGTAGAATCACAAC
JMFS156F12+ CTCAATTTTTTTTTTTCCTCAAACGATGATGAACTCAACACTTAACAGTAGAATCACAAC
                      ____________________________________________________________
consensus CTCAATTTTTTTTTTTCCTCAAACGATGATGAACTCAACACTTAACAGTAGAATCACAAC
 
. : . : . : . : . : . :
JMFS118F10+ GGACATAACAAGGGGTGCTGCTTCTCAAATTTAACAAAACATCCAACACCTATCTTAGAA
JMFS103B03+ GGACATAACAAGGGGTGCTGCTTCTCAAATTTAACAAAACATCCAACACCTATCTTAGAA
JMFS097F03+ GGACATAACAAGGGGTGCTGCTTCTCAAATTTAACAAAACATCCAACACCTATCTTAGAA
JMFS156F12+ GGACATAACAAGGGGTGCTGCTTCTCAAATTTAACAAAACATCCAACACCTATCTTAGAA
                      ____________________________________________________________
consensus GGACATAACAAGGGGTGCTGCTTCTCAAATTTAACAAAACATCCAACACCTATCTTAGAA
 
. : . : . : . : . : . :
JMFS118F10+ GGAATCTGCATTTGGCCTCGTGTGCAGATCATTCAAGGAAAACTGCTCACTAAGTACAAT
JMFS103B03+ GGAATCTGCATTTGGCCTCGTGTGCAGATCATTCAAGGAAAACTGCTCACTAAGTACAAT
JMSF005P19+ CTCACTAAGTACAAT
JMFS097F03+ GGAATCTGCATTTGGCCTCGTGTGCAGATCATTCAAGGAAAACTGCTCACTAAGTACAAT
JMFS156F12+ GGAATCTGCATTTGGCCTCGTGTGCAGATCATTCAAGGAAAACTGCTCACTAAGTACAAT
                      ____________________________________________________________
consensus GGAATCTGCATTTGGCCTCGTGTGCAGATCATTCAAGGAAAACTGCTCACTAAGTACAAT
 
. : . : . : . : . : . :
JMFS118F10+ TGACAAAGGAAACAAGGAAATCTCCAAAGGTGAGAAACCGCCAATCAAGCACTTCCTGGA
JMFS103B03+ TGACAAAGGAAACAAGGAAATCTCCAAAGGTGAGAAACCGCCAATCAAGCACTTCCTGGA
JMSF005P19+ TGACAAAGGAAACAAGGAAATCTCCAAAGGTGAGAAACCGCCAATCAAGCACTTCCTGGA
JMFS097F03+ TGACAAAGGAAACAAGGAAATCTCCAAAGGTGAGAAACCGCCAATCAAGCACTTCCTGGA
JMFS156F12+ TGACAAAGGAAACAAGGAAATCTCCAAAGGTGAGAAACCGCCAATCAAGCACTTCCTGGA
                      ____________________________________________________________
consensus TGACAAAGGAAACAAGGAAATCTCCAAAGGTGAGAAACCGCCAATCAAGCACTTCCTGGA
 
. : . : . : . : . : . :
JMFS118F10+ ATGAAAAACCTTGATACTTGTAGCAACTTGACCAAAGGCACATTTGCTCCATGTCCTAAG
JMFS103B03+ ATGAAAAACCTTGATACTTGTAGCAACTTGACCAAAGGCACATTTGCTCCATGTCCTAAG
JMSF005P19+ ATGAAAAACCTTGATACTTGTAGCAACTTGACCAAAGGCACATTTGCTCCATGTCCTAAG
JMFS097F03+ ATGAAAAACCTTGATACTTGTAGCAACTTGACCAAAGGCACATTTGCTCCATGTCCTAAG
JMFS156F12+ ATGAAAAACCTTGATACTTGTAGCAACTTGACCAAAGGCACATTTGCTCCATGTCCTAAG
                      ____________________________________________________________
consensus ATGAAAAACCTTGATACTTGTAGCAACTTGACCAAAGGCACATTTGCTCCATGTCCTAAG
 
. : . : . : . : . : . :
JMFS118F10+ TAATAATAATCCCTTGGAATTGAAGTCTAACAAGATCTGAGGGGTAAACGGCATAACCTA
JMFS103B03+ TAATAATAATCCCTTGGAATTGAAGTCTAACAAGATCTGAGGGGTAAACGGCATAACCTA
JMSF005P19+ TAATAATAATCCCTTGGAATTGAAGTCTAACAAGATCTGAGGGGTAAACGGCATAACCTA
JMFS097F03+ TAATAATAATCCCTTGGAATTGAAGTCTAACAAGATCTGAGGGGTAAACGGCATAACCTA
JMFS156F12+ TAATAATAATCCCTTGGAATTGAAGTCTAACAAGATCTGAGGGGTAAACGGCATAACCTA
                      ____________________________________________________________
consensus TAATAATAATCCCTTGGAATTGAAGTCTAACAAGATCTGAGGGGTAAACGGCATAACCTA
 
. : . : . : . : . : . :
JMFS118F10+ AGGGAGCCACGGAAGAAGAAATCCGGAGATCTTCTAGTATTCTA
JMFS103B03+ AGGGAGCCACGGAAGAAGAAATCCGGAGATCTTCTAGTATTCTATCAAAACCC
JMSF005P19+ AGGGAGCCA
JMFS097F03+ AGGGAGCCACGGAAGAAGAAATCCGGAGATCTTCTAGTATTCTATCAAAACCC
JMFS156F12+ AGGGAGCCACGGAAGAAGAAATCCGGAGATCTTCTAGTATTCTATCAAAACCCGATCGTT
                      ____________________________________________________________
consensus AGGGAGCCACGGAAGAAGAAATCCGGAGATCTTCTAGTATTCTATCAAAACCCGATCGTT