Previous Contig 004172:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS004G07Sequence409004172 (9)pir|T09538|T095382e-44acetyl-CoA carboxylase (EC 6.4.1.2) - alfalfa>gb:ALFACCASE_1818956 Medicago sati
JMFS021H03Sequence627004172 (9)gb:SOYACCAA_17159531e-77Glycine max (clone 91) acetyl-CoA-carboxylase (ACCase-A) mRNA, 3' end of cds.
JMFS063C10Sequence626004172 (9)pir|T07084|T070845e-70acetyl-CoA carboxylase (EC 6.4.1.2) A - soybean>gb:SOYACCASEA_1715954 Glycine ma
JMFS075E10Sequence627004172 (9)gb:SOYACCAA_17159533e-73Glycine max (clone 91) acetyl-CoA-carboxylase (ACCase-A) mRNA, 3' end of cds.
JMFS078D06Sequence627004172 (9)gb:SOYACCAA_17159534e-83Glycine max (clone 91) acetyl-CoA-carboxylase (ACCase-A) mRNA, 3' end of cds.
JMFS078D08Sequence627004172 (9)gb:SOYACCAA_17159534e-83Glycine max (clone 91) acetyl-CoA-carboxylase (ACCase-A) mRNA, 3' end of cds.
JMFS121D06Sequence585004172 (9)pir|T09538|T095382e-71acetyl-CoA carboxylase (EC 6.4.1.2) - alfalfa>gb:ALFACCASE_1818956 Medicago sati
JMFS139G09Sequence615004172 (9)gb:SOYACCAA_17159533e-72Glycine max (clone 91) acetyl-CoA-carboxylase (ACCase-A) mRNA, 3' end of cds.
JMFS156D03Sequence620004172 (9)pir|T07084|T070841e-71acetyl-CoA carboxylase (EC 6.4.1.2) A - soybean>gb:SOYACCASEA_1715954 Glycine ma

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS078D08+ GTCACTGCTTGGAAAAATGCATCTTCTCTTGGACCAAAAGATCCGTTTC
JMFS078D06+ GTCACTGCTTGGAAAAATGCATCTTCTCTTGGACCAAAAGATCCGTTTC
                      ____________________________________________________________
consensus GTCACTGCTTGGAAAAATGCATCTTCTCTTGGACCAAAAGATCCGTTTC
 
. : . : . : . : . : . :
JMFS078D08+ TGAAGGTGACATCATTTGCAACAATGATAATTTTCCTTCCAGAAGGGAACTCGGGTGTAG
JMFS078D06+ TGAAGGTGACATCATTTGCAACAATGATAATTTTCCTTCCAGAAGGGAACTCGGGTGTAG
                      ____________________________________________________________
consensus TGAAGGTGACATCATTTGCAACAATGATAATTTTCCTTCCAGAAGGGAACTCGGGTGTAG
 
. : . : . : . : . : . :
JMFS078D08+ ACATTTCCATAATCCAAGCCACCATGCCAACATCATTGAGCCCAGGCTTGCGTTCCACTG
JMFS078D06+ ACATTTCCATAATCCAAGCCACCATGCCAACATCATTGAGCCCAGGCTTGCGTTCCACTG
JMFS021H03+ AATCCAAGCCACCATGCCAACATCATTGAGCNCAGGCTTGCGTTCCACTG
                      ____________________________________________________________
consensus ACATTTCCATAATCCAAGCCACCATGCCAACATCATTGAGCCCAGGCTTGCGTTCCACTG
 
. : . : . : . : . : . :
JMFS078D08+ GAATAAGAGGAGTACCCCAACAGCCTTTTTGGTCCGAAAAAGTCAATTCGGTGACTTTAA
JMFS078D06+ GAATAAGAGGAGTACCCCAACAGCCTTTTTGGTCCGAAAAAGTCAATTCGGTGACTTTAA
JMFS021H03+ GAATAAGAGGAGTACCCCAACAGCCTTTTTGGTCCGAAAAAGTCAATTCGGTGACTTTAA
JMFS139G09+ AGCCTTTTTGGTCCGAAANAGTCAATTCGGTGACTTTAA
JMFS075E10+ TTTGGTCCGAAAAAGTCAATTCGGTGACTTTAA
                      ____________________________________________________________
consensus GAATAAGAGGAGTACCCCAACAGCCTTTTTGGTCCGAAAAAGTCAATTCGGTGACTTTAA
 
. : . : . : . : . : . :
JMFS078D08+ TGAGGTTTTCTTTAGGCTTGTTAGTTCTAGGAAATTCAGTAGCCCAAGACTTCTGCAATG
JMFS078D06+ TGAGGTTTTCTTTAGGCTTGTTAGTTCTAGGAAATTCAGTAGCCCAAGACTTCTGCAATG
JMFS021H03+ TGAGGTTTTCTTTAGGCTTGTTAGTTCTAGGAAATTCAGTAGCCCAAGACTTCTGCAATG
JMFS139G09+ TGAGGTTTTCTTTAGGCTTGTTAGTTCTAGGAAATTCAGTAGCCCAAGACTTCTGCAATG
JMFS075E10+ TGAGGTTTTCTTTAGGCTTGTTAGTTCTAGGAAATTCAGTAGCCCAAGACTTCTGCAATG
                      ____________________________________________________________
consensus TGAGGTTTTCTTTAGGCTTGTTAGTTCTAGGAAATTCAGTAGCCCAAGACTTCTGCAATG
 
. : . : . : . : . : . :
JMFS078D08+ CTACTTCAAAAGCCAGGGGGAAATCATAGCAGTAGGTTGTGCTGCTTTTACGGGCCACGA
JMFS078D06+ CTACTTCAAAAGCCAGGGGGAAATCATAGCAGTAGGTTGTGCTGCTTTTACGGGCCACGA
JMFS021H03+ CTACTTCAAAAGCCAGGGGGAAATCATAGCAGTAGGTTGTGCTGCTTTTACGGGCCACGA
JMFS139G09+ CTACTTCAAAAGCCAGGGGGAAATCATAGCAGTAGGTTGTGCTGCTTTTACGGGCCACGA
JMFS075E10+ CTACTTCAAAAGCCAGGGGGAAATCATAGCAGTAGGTTGTGCTGCTTTTACGGGCCACGA
                      ____________________________________________________________
consensus CTACTTCAAAAGCCAGGGGGAAATCATAGCAGTAGGTTGTGCTGCTTTTACGGGCCACGA
 
. : . : . : . : . : . :
JMFS078D08+ GTCGTTTCTGATCAAGAACTCCCAGAGGTTGATAATATGCAGTAACTGGCACGCAATGCA
JMFS078D06+ GTCGTTTCTGATCAAGAACTCCCAGAGGTTGATAATATGCAGTAACTGGCACGCAATGCA
JMFS021H03+ GTCGTTTCTGATCAAGAACTCCCAGAGGTTGATAATATGCAGTAACTGGCACGCAATGCA
JMFS139G09+ GTCGTTTCTGATCAAGAACTCCCAGAGGTTGATAATATGCAGTAACTGGCACGCAATGCA
JMFS075E10+ GTCGTTTCTGATCAAGAACTCCCAGAGGTTGATAATATGCAGTAACTGGCACGCAATGCA
                      ____________________________________________________________
consensus GTCGTTTCTGATCAAGAACTCCCAGAGGTTGATAATATGCAGTAACTGGCACGCAATGCA
 
. : . : . : . : . : . :
JMFS078D08+ GAGGACCCACCCCACTCGTGGAGTGATAGACGACTCTGTGTTTGTTTGTATCTTCCACCT
JMFS078D06+ GAGGACCCACCCCACTCGTGGAGTGATAGACGACTCTGTGTTTGTTTGTATCTTCCACCT
JMFS021H03+ GAGGACCCACCCCACTCGTGGAGTGATAGACGACTCTGTGTTTGTTTGTATCTTCCACCT
JMFS139G09+ GAGGACCCACCCCACTCGTGGAGTGATAGACGACTCTGTGTTTGTTTGTATCTTCCACCT
JMFS075E10+ GAGGACCCACCCCACTCGTGGAGTGATAGACGACTCTGTGTTTGTTTGTATCTTCCACCT
JMFS121D06+ ACGACTCTGTGTTTGTTTGTATCTTCCACCT
                      ____________________________________________________________
consensus GAGGACCCACCCCACTCGTGGAGTGATAGACGACTCTGTGTTTGTTTGTATCTTCCACCT
 
. : . : . : . : . : . :
JMFS078D08+ CACGGTAGATATTCACAATGCAGGTGTGGCCCGTCACATTTACAACCACAACTCTCCAAG
JMFS078D06+ CACGGTAGATATTCACAATGCAGGTGTGGCCCGTCACATTTACAACCACAACTCTCCAAG
JMFS021H03+ CACGGTAGATATTCACAATGCAGGTGTGGCCCGTCACATTTACAACCACAACTCTCCAAG
JMFS139G09+ CACGGTAGATATTCACAATGCAGGTGTGGCCCGTCACATTTACAACCACAACTCTCCAAG
JMFS075E10+ CACGGTAGATATTCACAATGCAGGTGTGGCCCGTCACATTTACAACCACAACTCTCCAAG
JMFS004G07+ CCGTCACATTTACAACCACAACTCTCCAAG
JMFS121D06+ CACGGTAGATATTCACAATGCAGGTGTGGCCCGTCACATTTACAACCACAACTCTCCAAG
                      ____________________________________________________________
consensus CACGGTAGATATTCACAATGCAGGTGTGGCCCGTCACATTTACAACCACAACTCTCCAAG
 
. : . : . : . : . : . :
JMFS078D08+ CACCATTGGCGTCTCCAGTGGATGATATCCAAAGCTTCACTTCCCACTCAAAAACACCTA
JMFS078D06+ CACCATTGGCGTCTCCAGTGGATGATATCCAAAGCTTCACTTCCCACTCAAAAACACCTA
JMFS021H03+ CACCATTGGCGTCTCCAGTGGATGATATCCAAAGCTTCACTTCCCACTCAAAAACACCTA
JMFS139G09+ CACCATTGGCGTCTCCAGTGGATGATATCCAAAGCTTCACTTCCCACTCAAAAACACCTA
JMFS075E10+ CACCATTGGCGTCTCCAGTGGATGATATCCAAAGCTTCACTTCCCACTCAAAAACACCTA
JMFS004G07+ CACCATTGGCGTCTCCAGTGGATGATATCCAAAGCTTCACTTCCCACTCAAAAACACCTA
JMFS121D06+ CACCATTGGCGTCTCCAGTGGATGATATCCAAAGCTTCACTTCCCACTCAAAAACACCTA
                      ____________________________________________________________
consensus CACCATTGGCGTCTCCAGTGGATGATATCCAAAGCTTCACTTCCCACTCAAAAACACCTA
 
. : . : . : . : . : . :
JMFS078D08+ AACGGTGCATTTTTACACCAACAGATGCATTGATTTCA
JMFS078D06+ AACGGTGCATTTTTACACCAACAGATGCATTGATTTCA
JMFS021H03+ AACGGTGCATTTTTACACCAACAGATGCATTGATTTCACGTGCCATTTCATCTAAAATTT
JMFS139G09+ AACGGTGCATTTTTACACCAACAGATGCATTGATTTCACGTGCCATTTCATCTAAAATTT
JMFS075E10+ AACGGTGCATTTTTACACCAACAGATGCATTGATTTCACGTGCCATTTCATCTAAAATTT
JMFS004G07+ AACGGTGCATTTTTACACCAACAGATGCATTGATTTCACGTGCCATTTCATCTAAAATTT
JMFS121D06+ AACGGTGCATTTTTACACCAACAGATGCATTGATTTCACGTGCCATTTCATCTAAAATTT
JMFS063C10+ ATTTTTACACCAACAGATGCATTGATTTCACGTGCCATTTCATCTAAAATTT
                      ____________________________________________________________
consensus AACGGTGCATTTTTACACCAACAGATGCATTGATTTCACGTGCCATTTCATCTAAAATTT
 
. : . : . : . : . : . :
JMFS021H03+ GGTCTACAACTGCTTCTTCATTACCATTATATACATCTACTCGCTTGTTATAGGGCAACA
JMFS139G09+ GGTCTACAACTGCTTCTTCATTACCATTATATACATCTACTCGCTTGTTATAGGGCAACA
JMFS075E10+ GGTCTACAACTGCTTCTTCATTACCATTATATACATCTACTCGCTTGTTATAGGGCAACA
JMFS004G07+ GGTCTACAACTGCTTCTTCATTACCATTATATACATCTACTCGCTTGTTATAGGGCAACA
JMFS121D06+ GGTCTACAACTGCTTCTTCATTACCATTATATACATCTACTCGCTTGTTATAGGGCAACA
JMFS063C10+ GGTCTACAACTGCTTCTTCATTACCATTATATACATCTACTCGCTTGTTATAGGGCAACA
                      ____________________________________________________________
consensus GGTCTACAACTGCTTCTTCATTACCATTATATACATCTACTCGCTTGTTATAGGGCAACA
 
. : . : . : . : . : . :
JMFS021H03+ GATCCTCTATTTGTTGCTCCCTTAAAATATAGAGGTA
JMFS139G09+ GATCCTCTATTTGTTGCTCCCTTAAAATATAGAGGTACATATTCACATGGTCAGATTTGA
JMFS075E10+ GATCCTCTATTTGTTGCTCCCTTAAAATATAGAGGTACATATTCACATGGTCAGATTTGA
JMFS004G07+ GATCCTCTATTTGTTGCTCCCTTAAAATATAGAGGTACATATTCACATGGTCAGATTTGA
JMFS121D06+ GATCCTCTATTTGTTGCTCCCTTAAAATATAGAGGTACATATTCACATGGTCAGATTTGA
JMFS063C10+ GATCCTCTATTTGTTGCTCCCTTAAAATATAGAGGTACATATTCACATGGTCAGATTTGA
JMFS156D03+ ATTCACATGGTCAGATTTGA
                      ____________________________________________________________
consensus GATCCTCTATTTGTTGCTCCCTTAAAATATAGAGGTACATATTCACATGGTCAGATTTGA
 
. : . : . : . : . : . :
JMFS139G09+ CGGTTGAATTATGGACATTAAGCTCAAGCTCCTCAA
JMFS075E10+ CGGTTGAATTATGGACATTAAGCTCAAGCTCCTCAAGTGCAGATGTTAAAGATC
JMFS004G07+ CGGTTGAATTATGGACATTAAGCTCAAGCTCCTCAAGTGCAGATGTTAAAGATCTCAAAA
JMFS121D06+ CGGTTGAATTATGGACATTAAGCTCAAGCTCCTCAAGTGCAGATGTTAAAGATCTCAAAA
JMFS063C10+ CGGTTGAATTATGGACATTAAGCTCAAGCTCCTCAAGTGCAGATGTTAAAGATCTCAAAA
JMFS156D03+ CGGTTGAATTATGGACATTAAGCTCAAGCTCCTCAAGTGCAGATGTTAAAGATCTCAAAA
                      ____________________________________________________________
consensus CGGTTGAATTATGGACATTAAGCTCAAGCTCCTCAAGTGCAGATGTTAAAGATCTCAAAA
 
. : . : . : . : . : . :
JMFS004G07+ TGCTCCTTGAAGTAAAAGACAATGAAAATGGGGCATGAGTTTTTTGACGATCTAGCCCTT
JMFS121D06+ TGCTCCTTGAAGTAAAAGACAATGAAAATGGGGCATGAGTTTTTTGACGATCTAGCCCTT
JMFS063C10+ TGCTCCTTGAAGTAAAAGACAATGAAAATGGGGCATGAGTTTTTTGACGATCTAGCCCTT
JMFS156D03+ TGCTCCTTGAAGTAAAAGACAATGAAAATGGGGCATGAGTTTTTTGACGATCTAGCCCTT
                      ____________________________________________________________
consensus TGCTCCTTGAAGTAAAAGACAATGAAAATGGGGCATGAGTTTTTTGACGATCTAGCCCTT
 
. : . : . : . : . : . :
JMFS004G07+ GAAACACTGGTAAACCTTC
JMFS121D06+ GAAACACTGGTAAACCTTCATCTGACATGGGTTGTCTCACAAGTGTTCTGAGAAACATCC
JMFS063C10+ GAAACACTGGTAAACCTTCATCTGACATGGGTTGTCTCACAAGTGTTCTGAGAAACATCC
JMFS156D03+ GAAACACTGGTAAACCTTCATCTGACATGGGTTGTCTCACAAGTGTTCTGAGAAACATCC
                      ____________________________________________________________
consensus GAAACACTGGTAAACCTTCATCTGACATGGGTTGTCTCACAAGTGTTCTGAGAAACATCC
 
. : . : . : . : . : . :
JMFS121D06+ TCTGGATTGGGCGAGGCTTGTCTACAACAGTGTACAGGTGCCACTGACGGTCCCTTGATT
JMFS063C10+ TCTGGATTGGGCGAGGCTTGTCTACAACAGTGTACAGGTGCCACTGACGGTCCCTTGATT
JMFS156D03+ TCTGGATTGGGCGAGGCTTGTCTACAACAGTGTACAGGTGCCACTGACGGTCCCTTGATT
                      ____________________________________________________________
consensus TCTGGATTGGGCGAGGCTTGTCTACAACAGTGTACAGGTGCCACTGACGGTCCCTTGATT
 
. : . : . : . : . : . :
JMFS121D06+ GTGCGTACTTAATT
JMFS063C10+ GTGCGTACTTAATTTTGTCATAGCCATTGAGCTTATCCAATTCAAGGTAAATTGATAGAG
JMFS156D03+ GTGCGTACTTAATTTTGTCATAGCCATTGAGCTTATCCAATTCAAGGTAAATTGATAGAG
                      ____________________________________________________________
consensus GTGCGTACTTAATTTTGTCATAGCCATTGAGCTTATCCAATTCAAGGTAAATTGATAGAG
 
. : . : . : . : . : . :
JMFS063C10+ GAGGCTCAAGGTGACGTAATAGAGGCTCCTCCTGGTAATAGCGCTTCTCTTCTGACCAAT
JMFS156D03+ GAGGCTCAAGGTGACGTAATAGAGGCTCCTCCTGGTAATAGCGCTTCTCTTCTGACCAAT
                      ____________________________________________________________
consensus GAGGCTCAAGGTGACGTAATAGAGGCTCCTCCTGGTAATAGCGCTTCTCTTCTGACCAAT
 
. : . : . : . : . : . :
JMFS063C10+ GAAAGGAGTGCCTCATAGGGCCTCGTCCCTCGTCCCTTTGTATGATACAGCTGATCACCC
JMFS156D03+ GAAAGGAGTGCCTCATAGGGCCTCGTCCCTCGTCCCTTTGTATGATACAGCTGATCACCC
                      ____________________________________________________________
consensus GAAAGGAGTGCCTCATAGGGCCTCGTCCCTCGTCCCTTTGTATGATACAGCTGATCACCC
 
. : . : . : . : . : . :
JMFS063C10+ CTACCCCTGCATTTTTAAGGATGGAGCTTATATC
JMFS156D03+ CTACCCCTGCATTTTTAAGGATGGAGCTTATATCTCTCTCTTTCAATATTTTTGCTAACT
                      ____________________________________________________________
consensus CTACCCCTGCATTTTTAAGGATGGAGCTTATATCTCTCTCTTTCAATATTTTTGCTAACT
 
. : . : . : . : . : . :
JMFS156D03+ TGTCGACTCTCTCTTGAGCCTGATCCTCATCACCACTGTCCTGAAGTGTACTCATTTGAT
                      ____________________________________________________________
consensus TGTCGACTCTCTCTTGAGCCTGATCCTCATCACCACTGTCCTGAAGTGTACTCATTTGAT
 
. : . : . : . : . : . :
JMFS156D03+ TGTTGATGCCTGCCAATGCAATGTGTATCATGTTACCATGACCCTCTGTCCCCACGGATC
                      ____________________________________________________________
consensus TGTTGATGCCTGCCAATGCAATGTGTATCATGTTACCATGACCCTCTGTCCCCACGGATC