Previous Contig 004171:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS028E07Sequence662004171 (2)gb:BT011692_16412145e-68Arabidopsis thaliana At3g14067 gene, complete cds.>gb:BT012275_1641481 Arabidops
JMFS156C09Sequence593004171 (2)gb:AP004846_18458842e-57Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS028E07+ TACATAATCATGAGTNCCGGTATCATAAAC
                      ____________________________________________________________
consensus TACATAATCATGAGTNCCGGTATCATAAAC
 
. : . : . : . : . : . :
JMFS028E07+ CAGACCCGGATCTGCTACCCTGGTTGGATCAACGTGCCCAGATCCATGAAAATAGGGCAC
                      ____________________________________________________________
consensus CAGACCCGGATCTGCTACCCTGGTTGGATCAACGTGCCCAGATCCATGAAAATAGGGCAC
 
. : . : . : . : . : . :
JMFS028E07+ GGATGGTTGTCCAGTGGAAAGATCTATTATGGGACTCTCTTCGGATTTATGCACAGTGTA
                      ____________________________________________________________
consensus GGATGGTTGTCCAGTGGAAAGATCTATTATGGGACTCTCTTCGGATTTATGCACAGTGTA
 
. : . : . : . : . : . :
JMFS028E07+ AGCTGTTGTCATGAGTGCAGACTTGATGGCACCTGGGTTCCACAGTGGATAGAGCTTTTG
                      ____________________________________________________________
consensus AGCTGTTGTCATGAGTGCAGACTTGATGGCACCTGGGTTCCACAGTGGATAGAGCTTTTG
 
. : . : . : . : . : . :
JMFS028E07+ AAGCATGGCGGCCAATCCACTAACATGAGGACATGCCATGGAGGTGCCGGACATAATATT
                      ____________________________________________________________
consensus AAGCATGGCGGCCAATCCACTAACATGAGGACATGCCATGGAGGTGCCGGACATAATATT
 
. : . : . : . : . : . :
JMFS028E07+ GAATTCCGTTTTTCTTTTATCGGAGGGAGATTGGGAGGGGCCTTCAGTGTCAATCCAGGC
                      ____________________________________________________________
consensus GAATTCCGTTTTTCTTTTATCGGAGGGAGATTGGGAGGGGCCTTCAGTGTCAATCCAGGC
 
. : . : . : . : . : . :
JMFS028E07+ GGCTAGAATGTTAACTCCTGGTGCAATCACATCTGGTTTGAGAATTTCAGGAGTCACGAA
JMFS156C09+ CTAGAATGTTAACTCCTGGCGCAATCACGTCCGGTTTGAGAATTTCAGGAGTGATACG
                      ____________________________________________________________
consensus GGCTAGAATGTTAACTCCTGGTGCAATCACGTCTGGTTTGAGAATTTCAGGAGTGATGCG
 
. : . : . : . : . : . :
JMFS028E07+ ATTGGGGCCTCGGCTTGAGAAAGCAGCCACACGCGGTGC
JMFS156C09+ ATTAGGGCCGCGGCTTGAGAAAGCCGCCACACGCGGTGCCGACGGCGAGGAGGCTCCTCC
                      ____________________________________________________________
consensus ATTGGGGCCTCGGCTTGAGAAAGCCGCCACACGCGGTGCCGACGGCGAGGAGGCTCCTCC
 
. : . : . : . : . : . :
JMFS156C09+ GATTACGGTTCCCCGGGATGCAATTGTAGCGGTTGGCCAGGGATTGGACCTTATATACTC
                      ____________________________________________________________
consensus GATTACGGTTCCCCGGGATGCAATTGTAGCGGTTGGCCAGGGATTGGACCTTATATACTC
 
. : . : . : . : . : . :
JMFS156C09+ CCGGATTTTGTCTCCGTCGCTTGTAGAAACAAGTGACGTCGGAATCCGATGCGGCTGCGC
                      ____________________________________________________________
consensus CCGGATTTTGTCTCCGTCGCTTGTAGAAACAAGTGACGTCGGAATCCGATGCGGCTGCGC
 
. : . : . : . : . : . :
JMFS156C09+ CATAAGCTGTTCGCCATAACCAGGCCGGTTAGCAATGATGATTCCAACGCCGCCAGCTTG
                      ____________________________________________________________
consensus CATAAGCTGTTCGCCATAACCAGGCCGGTTAGCAATGATGATTCCAACGCCGCCAGCTTG
 
. : . : . : . : . : . :
JMFS156C09+ TGTTACAGCAATTCCTTTTGAAATCTCTGAAATATCGCCTTGTGATAAGGACTCACAAAA
                      ____________________________________________________________
consensus TGTTACAGCAATTCCTTTTGAAATCTCTGAAATATCGCCTTGTGATAAGGACTCACAAAA
 
. : . : . : . : . : . :
JMFS156C09+ CACGATTCTTCCCCAGACTTTTGAAGCATCAAGTTCTCCGGGACGACAGTATATGCTGTT
                      ____________________________________________________________
consensus CACGATTCTTCCCCAGACTTTTGAAGCATCAAGTTCTCCGGGACGACAGTATATGCTGTT