Previous Contig 004154:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS111B11Sequence624004154 (2)pir|T02131|T021312e-90hypothetical protein F8K4.6 - Arabidopsis thaliana>gb:AE005173_893856 Arabidopsi
JMFS154G09Sequence626004154 (2)pir|T02131|T021313e-86hypothetical protein F8K4.6 - Arabidopsis thaliana>gb:AE005173_893856 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS111B11+ CATCAGAGAAATCATCAAGATAATATGGTGCAGCAGATGATGCACGTATGGCTTGCCAA
                      ____________________________________________________________
consensus CATCAGAGAAATCATCAAGATAATATGGTGCAGCAGATGATGCACGTATGGCTTGCCAA
 
. : . : . : . : . : . :
JMFS111B11+ ACATGATGCTTGCAGCTTCCAATAAAGGCATTACGCTTCAATCCAACTTGAGCTCCAGTA
                      ____________________________________________________________
consensus ACATGATGCTTGCAGCTTCCAATAAAGGCATTACGCTTCAATCCAACTTGAGCTCCAGTA
 
. : . : . : . : . : . :
JMFS111B11+ GTTGCTGCTCCCACACCCCCTATTGCCGGCTCTGGCGTACCAGGAGGGTACTGATAATTT
                      ____________________________________________________________
consensus GTTGCTGCTCCCACACCCCCTATTGCCGGCTCTGGCGTACCAGGAGGGTACTGATAATTT
 
. : . : . : . : . : . :
JMFS111B11+ CGGAATATGAAGGGTTGAGCTGGTGACACGCTGACCAGAGTTGACACTACAAAAACTTTA
                      ____________________________________________________________
consensus CGGAATATGAAGGGTTGAGCTGGTGACACGCTGACCAGAGTTGACACTACAAAAACTTTA
 
. : . : . : . : . : . :
JMFS111B11+ GGAATGCCTTTCACTGCTGACTCTATAAGAAGATCTCCATCCTCATCAGTGCATAGCTCC
                      ____________________________________________________________
consensus GGAATGCCTTTCACTGCTGACTCTATAAGAAGATCTCCATCCTCATCAGTGCATAGCTCC
 
. : . : . : . : . : . :
JMFS111B11+ CTCAACAATCTCTCAAACTGATCAGCACTGTGTTTAGATCCATGTACAACGACTCGGAAA
                      ____________________________________________________________
consensus CTCAACAATCTCTCAAACTGATCAGCACTGTGTTTAGATCCATGTACAACGACTCGGAAA
 
. : . : . : . : . : . :
JMFS111B11+ CTCTGAGATGAGCTCTTGTAGAGTTGATCCAGCTTTTCTCTCCAAGATGCTGCTTCATTG
                      ____________________________________________________________
consensus CTCTGAGATGAGCTCTTGTAGAGTTGATCCAGCTTTTCTCTCCAAGATGCTGCTTCATTG
 
. : . : . : . : . : . :
JMFS111B11+ TCCTTCGGAACAGGTTCAGCAAATACGAGCTTTCCAAGATCCTTGTATACTTCTTCACAT
                      ____________________________________________________________
consensus TCCTTCGGAACAGGTTCAGCAAATACGAGCTTTCCAAGATCCTTGTATACTTCTTCACAT
 
. : . : . : . : . : . :
JMFS111B11+ TTTTCCAAAGACATCAGCTTGATTCCAAGAGCGACTGCAAGCATGCCACCAGTTGATGTG
JMFS154G09+ CTGCAAGCATGCCACCAGTTGATGTG
                      ____________________________________________________________
consensus TTTTCCAAAGACATCAGCTTGATTCCAAGAGCGACTGCAAGCATGCCACCAGTTGATGTG
 
. : . : . : . : . : . :
JMFS111B11+ CCACAAATAAGGTCAAAGAGCTCATGTATCCGTTTCCCAGTACCTTTCTCAATTTCCTTA
JMFS154G09+ CCACAAATAAGGTCAAAGAGCTCATGTATCCGTTTCCCAGTACCTTTCTCAATTTCCTTA
                      ____________________________________________________________
consensus CCACAAATAAGGTCAAAGAGCTCATGTATCCGTTTCCCAGTACCTTTCTCAATTTCCTTA
 
. : . : . : . : . : . :
JMFS111B11+ AGAATTCTTACAGTTGCCAGACCTT
JMFS154G09+ AGAATTCTTACAGTTGCCAGACCTTTCATTCCACCACCATCCATTGAAAGTATGCGTAAC
                      ____________________________________________________________
consensus AGAATTCTTACAGTTGCCAGACCTTTCATTCCACCACCATCCATTGAAAGTATGCGTAAC
 
. : . : . : . : . : . :
JMFS154G09+ CCCTGCTTGGGCACCTGTCTGACTCGAATAGCACGCCGTAGAACCTCATTCTCCCCTAGA
                      ____________________________________________________________
consensus CCCTGCTTGGGCACCTGTCTGACTCGAATAGCACGCCGTAGAACCTCATTCTCCCCTAGA
 
. : . : . : . : . : . :
JMFS154G09+ ATTGCTAGAGCTCGAGCTGCAGCCTTGCTCACGCGTGGCTCGGATGAAGCAGTCAGGCGT
                      ____________________________________________________________
consensus ATTGCTAGAGCTCGAGCTGCAGCCTTGCTCACGCGTGGCTCGGATGAAGCAGTCAGGCGT
 
. : . : . : . : . : . :
JMFS154G09+ AGAAGAAGTTCCCTTAAGCTTTCTGGCGCAACAAGAACACACCGGTTTTCTGAGCAGAAA
                      ____________________________________________________________
consensus AGAAGAAGTTCCCTTAAGCTTTCTGGCGCAACAAGAACACACCGGTTTTCTGAGCAGAAA
 
. : . : . : . : . : . :
JMFS154G09+ GCTAAATTTCCAACTGCAAATAAAGCTAACCTTTGTACCTCAGGATTTTTGTGAGCACAT
                      ____________________________________________________________
consensus GCTAAATTTCCAACTGCAAATAAAGCTAACCTTTGTACCTCAGGATTTTTGTGAGCACAT
 
. : . : . : . : . : . :
JMFS154G09+ AATAATTTCAATGACTTCAATACATCCTTGGTCAGCATTTTTTGAGAAACAGTATCAGAG
                      ____________________________________________________________
consensus AATAATTTCAATGACTTCAATACATCCTTGGTCAGCATTTTTTGAGAAACAGTATCAGAG
 
. : . : . : . : . : . :
JMFS154G09+ GCCAAAGCCAACTTTGCTAATACTTGCAAAACAGATATAACTTCCTCAGGTCTAGAAGAT
                      ____________________________________________________________
consensus GCCAAAGCCAACTTTGCTAATACTTGCAAAACAGATATAACTTCCTCAGGTCTAGAAGAT
 
. : . : . : . : . : . :
JMFS154G09+ CTAAGTACTCTTTCTATAGGTTGCATGATATCAGATTTCATTAACTGCATTGCAACAGAG
                      ____________________________________________________________
consensus CTAAGTACTCTTTCTATAGGTTGCATGATATCAGATTTCATTAACTGCATTGCAACAGAG
 
. : . : . : . : . : . :
JMFS154G09+ ACATCTGAGGCAAGAGATGTAAGAGCAGAGCAAGCCTGTTCTACCACATGCTGATTCTCA
                      ____________________________________________________________
consensus ACATCTGAGGCAAGAGATGTAAGAGCAGAGCAAGCCTGTTCTACCACATGCTGATTCTCA