Previous Contig 004150:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001N06Sequence452004150 (11)gb:AB020742_15145629e-29Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21H1.>gb:BT012577_164659002414 (8)pir|T07169|T071699e-33subtilisin-like proteinase (EC 3.4.21.-) 3 - tomato>gb:LES6376_1684619 Lycopersi
JMFF012M19Sequence439004150 (11)gb:AB020742_15145621e-26Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21H1.>gb:BT012577_164733002414 (8)pir|T07169|T071698e-41subtilisin-like proteinase (EC 3.4.21.-) 3 - tomato>gb:LES6376_1684619 Lycopersi
JMFS005A12Sequence489004150 (11)gb:AC119292_17397055e-52Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0088F07, complet
JMFS075A07Sequence628004150 (11)pir|T07170|T071703e-58subtilisin-like proteinase (EC 3.4.21.-) 4 - tomato>gb:LES6377_1684620 Lycopersi
JMFS079A08Sequence618004150 (11)gb:AC119292_17397058e-40Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0088F07, complet
JMFS090C10Sequence627004150 (11)pir|T07170|T071703e-58subtilisin-like proteinase (EC 3.4.21.-) 4 - tomato>gb:LES6377_1684620 Lycopersi
JMFS149H04Sequence621004150 (11)pir|T07170|T071704e-62subtilisin-like proteinase (EC 3.4.21.-) 4 - tomato>gb:LES6377_1684620 Lycopersi
JMFS154C08Sequence623004150 (11)gb:LES6480_16846258e-12Lycopersicon esculentum sbt4b gene.
JMSF005D20Sequence342004150 (11)gb:LES6483_16846285e-16Lycopersicon esculentum sbt4e gene.310013129 (3)gb:AP001313_18211711e-08Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:T5M7.
JMSF026A11Sequence660004150 (11)pir|T07170|T071701e-52subtilisin-like proteinase (EC 3.4.21.-) 4 - tomato>gb:LES6377_1684620 Lycopersi802002414 (8)pir|T07169|T071697e-44subtilisin-like proteinase (EC 3.4.21.-) 3 - tomato>gb:LES6376_1684619 Lycopersi
JMSF040K03Sequence690004150 (11)pir|T07170|T071704e-64subtilisin-like proteinase (EC 3.4.21.-) 4 - tomato>gb:LES6377_1684620 Lycopersi870002414 (8)pir|T07169|T071692e-58subtilisin-like proteinase (EC 3.4.21.-) 3 - tomato>gb:LES6376_1684619 Lycopersi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS079A08+ TCCCAGG
                      ____________________________________________________________
consensus TCCCAGG
 
. : . : . : . : . : . :
JMFS079A08+ ACTGTCATCTTAAATTCCAGCTTTGCTTTTGGCGCGGAATTGGATTTAATGTAGTTGATA
                      ____________________________________________________________
consensus ACTGTCATCTTAAATTCCAGCTTTGCTTTTGGCGCGGAATTGGATTTAATGTAGTTGATA
 
. : . : . : . : . : . :
JMFS079A08+ ACTTTTTCGCCGTCTTCAATGGTTAAAAACACAGAGGGGATTTGGTTCTGTAGCAAGAAT
                      ____________________________________________________________
consensus ACTTTTTCGCCGTCTTCAATGGTTAAAAACACAGAGGGGATTTGGTTCTGTAGCAAGAAT
 
. : . : . : . : . : . :
JMFS079A08+ TCTAAGTTGGTCTCATTGGTTATGAAAACGCCGCCACCGACTTTTCCGTTTTGGAGGTTG
                      ____________________________________________________________
consensus TCTAAGTTGGTCTCATTGGTTATGAAAACGCCGCCACCGACTTTTCCGTTTTGGAGGTTG
 
. : . : . : . : . : . :
JMFS079A08+ AATACTTGGTCCGCGACCGTGCCGTTCTTGTCGAGACACACGACAATTTTGTCGCCAGCG
                      ____________________________________________________________
consensus AATACTTGGTCCGCGACCGTGCCGTTCTTGTCGAGACACACGACAATTTTGTCGCCAGCG
 
. : . : . : . : . : . :
JMFS079A08+ TTCTGCAACTGCTTCGTGTCGGTGCATTCCCCGAGAAAAACGGCCGGCAACGAGGTGGAA
                      ____________________________________________________________
consensus TTCTGCAACTGCTTCGTGTCGGTGCATTCCCCGAGAAAAACGGCCGGCAACGAGGTGGAA
 
. : . : . : . : . : . :
JMFS079A08+ GTGGAATTCCCAGGATACAGAGACAAACCAGAGACGGAAACTCCATTGTCAAGAGTCAAC
                      ____________________________________________________________
consensus GTGGAATTCCCAGGATACAGAGACAAACCAGAGACGGAAACTCCATTGTCAAGAGTCAAC
 
. : . : . : . : . : . :
JMFS079A08+ GCCCCCCGGAACTCCCGGTCAACGGTGCCGGCCGCCACCGTGAGAAGCCAAGGCGTCCCG
                      ____________________________________________________________
consensus GCCCCCCGGAACTCCCGGTCAACGGTGCCGGCCGCCACCGTGAGAAGCCAAGGCGTCCCG
 
. : . : . : . : . : . :
JMFS079A08+ TTGTGGAGAGAGGCGAAGTAGGGCCCTTGGTTCCCTGCCGAAGTGGAAACGAAAACGTTC
                      ____________________________________________________________
consensus TTGTGGAGAGAGGCGAAGTAGGGCCCTTGGTTCCCTGCCGAAGTGGAAACGAAAACGTTC
 
. : . : . : . : . : . :
JMFS079A08+ TTCTCCATTGCGGCAAATGCGGCTATGGCGATGGGGTCTTCATACAGAGCAAGCCCGTCA
JMFS005A12+ CAAATGCGGCTATGGCGATGGGGTCTTCATACAGAGCAAGCCCGTCA
                      ____________________________________________________________
consensus TTCTCCATTGCGGCAAATGCGGCTATGGCGATGGGGTCTTCATACAGAGCAAGCCCGTCA
 
. : . : . : . : . : . :
JMFS079A08+ ACGCCGAGAGATAACGACAGGACGTCTACTCCGTCCACCAATGCCTGATCAATGGCGGCG
JMFS005A12+ ACGCCGAGAGATAACGACAGGACGTCTACTCCGTCCACCAATGCCTGATCAATGGCGGCG
                      ____________________________________________________________
consensus ACGCCGAGAGATAACGACAGGACGTCTACTCCGTCCACCAATGCCTGATCAATGGCGGCG
 
. : . : . : . : . : . :
JMFS079A08+ ATAATATCGGA
JMFS005A12+ ATAATATCGGAGAGCTGAACGCCTTCATCCCAGAGCGCCTTGTACATAGCAACCCGAGCT
                      ____________________________________________________________
consensus ATAATATCGGAGAGCTGAACGCCTTCATCCCAGAGCGCCTTGTACATAGCAACCCGAGCT
 
. : . : . : . : . : . :
JMFS005A12+ TTTGGAGCTATGCCGGTGGCTACACCCGTGGCGTAGCCGAAAAACGTTGCGCCCTCCACG
                      ____________________________________________________________
consensus TTTGGAGCTATGCCGGTGGCTACACCCGTGGCGTAGCCGAAAAACGTTGCGCCCTCCACG
 
. : . : . : . : . : . :
JMFS005A12+ CGGCCGCCGGCCGCCGTGGAGGAAGTGTGGGTCCCATGGCCGTCCGTGTCGCGGGCAGAG
JMFS075A07+ CGTCCGTGTCGCGGGCAGAG
JMFS090C10+ GCCGTCCGTGTCGCGGGCAGAG
JMFS149H04+ AGTGTGGGTCCCATGGCCGTCCGTGTCGCGGGCAGAG
JMSF040K03+ CGGCCGCCGGCCGCCGTGGAGGAAGTGTGGGTCCCATGGCCGTCCGTGTCGCGGGCAGAG
                      ____________________________________________________________
consensus CGGCCGCCGGCCGCCGTGGAGGAAGTGTGGGTCCCATGGCCGTCCGTGTCGCGGGCAGAG
 
. : . : . : . : . : . :
JMFS005A12+ TTCATGGAAATAGTTAAATTAGGATTCTTGGCAAGCAGGCCTTTGTTAAAGTAACGAGCT
JMFS075A07+ TTCATGGAAATAGTTAAATTAGGATTCTTGGCAAGCAGGCCTTTGTTAAAGTAACGAGCT
JMFS090C10+ TTCATGGAAATAGTTAAATTAGGATTCTTGGCAAGCAGGCCTNTGTTAAAGTAACGAGCT
JMFS149H04+ TTCATGGAAATAGTTAAATTAGGATTCTTGGCAAGCAGGCCTTTGTTAAAGTAACGAGCT
JMSF040K03+ TTCATGGAAATAGTTAAATTAGGATTCTTGGCAAGCAGGCCTTTGTTAAAGTAACGAGCT
JMSF026A11+ ATTAGGATTCTTGGCAAGCAGGCCTTTGTTAAAGTAACGAGCT
                      ____________________________________________________________
consensus TTCATGGAAATAGTTAAATTAGGATTCTTGGCAAGCAGGCCTTTGTTAAAGTAACGAGCT
 
. : . : . : . : . : . :
JMFS005A12+ CCGATGAGTTTCTTGTTACACATGGAAGGAGTAAACTGAGTTCCACTCTGGCATTCCCCT
JMFS075A07+ CCGATGAGTTTCTTGTTACACATGGAAGGAGTAAACTGAGTTCCACTCTGGCATTCCCCT
JMFS090C10+ CCGATGAGTTTCTTGTTACACATGGAAGGAGTAAACTGAGTTCCACTCTGGCATTCCCCT
JMFS149H04+ CCGATGAGTTTCTTGTTACACATGGAAGGAGTAAACTGAGTTCCACTCTGGCATTCCCCT
JMSF040K03+ CCGATGAGTTTCTTGTTACACATGGAAGGAGTAAACTGAGTTCCACTCTGGCATTCCCCT
JMSF026A11+ CCGATGAGTTTCTTGTTACACATGGAAGGAGTAAACTGAGTTCCACTCTGGCATTCCCCT
                      ____________________________________________________________
consensus CCGATGAGTTTCTTGTTACACATGGAAGGAGTAAACTGAGTTCCACTCTGGCATTCCCCT
 
. : . : . : . : . : . :
JMFS005A12+ TTCCACCTCGCCGGAATTTCCCCCATCCCATCATCTCCAAAGCTCTTACTCTCCGGCCAA
JMFS075A07+ TTCCACCTCGCCGGAATTTCCCCCATCCCATCATCTCCAAAGCTCTTACTCTCCGGCCAA
JMFS090C10+ TTCCACCTCGCCGGAATTTCCCCCATCCCATCATCTCCAAAGCTCTTACTCTCCGGCCAA
JMFS149H04+ TTCCACCTCGCCGGAATTTCCCCCATCCCATCATCTCCAAAGCTCTTACTCTCCGGCCAA
JMSF040K03+ TTCCACCTCGCCGGAATTTCCCCCATCCCATCATCTCCAAAGCTCTTACTCTCCGGCCAA
JMSF026A11+ TTCCACCTCGCCGGAATTTCCCCCATCCCATCATCTCCAAAGCTCTTACTCTCCGGCCAA
                      ____________________________________________________________
consensus TTCCACCTCGCCGGAATTTCCCCCATCCCATCATCTCCAAAGCTCTTACTCTCCGGCCAA
 
. : . : . : . : . : . :
JMFS005A12+ ACCCCGGTGTCAATCACCCCAA
JMFS075A07+ ACCCCGGTGTCAATCACCCCAATAATAACATCACGGCCGTAGTCCGTCGCCGGCCATGCA
JMFS090C10+ ACCCCGGTGTCAATCACCCCAATAATAACATCACGGCCGTAGTCCGTCGCCGGCCATGCA
JMFS149H04+ ACCCCGGTGTCAATCACCCCAATAATAACATCACGGCCGTAGTCCGTCGCCGGCCATGCA
JMSF040K03+ ACCCCGGTGTCAATCACCCCAATAATAACATCACGGCCGTAGTCCGTCGCCGGCCATGCA
JMFF012M19+ CCCCAATAATAACATCACGGCCGTAGTCCGTCGCCGGCCATGCA
JMFF001N06+ CCGGTGTCAATCACCCCAATAATAACATCACGGCCGTAGTCCGTCGCCGGCCATGCA
JMSF026A11+ ACCCCGGTGTCAATCACCCCAATAATAACATCACGGCCGTAGTCCGTCGCCGGCCATGCA
                      ____________________________________________________________
consensus ACCCCGGTGTCAATCACCCCAATAATAACATCACGGCCGTAGTCCGTCGCCGGCCATGCA
 
. : . : . : . : . : . :
JMFS075A07+ CCGTGGTCGGAACTGAGCCCAAGGAATCCCGGCGTGTGGGAAGTGTCAACTTTAACTGAA
JMFS090C10+ CCGTGGTCGGAACTGAGCCCAAGGAATCCCGGCGTGTGGGAAGTGTCAACTTTAACTGAA
JMFS149H04+ CCGTGGTCGGAACTGAGCCCAAGGAATCCCGGCGTGTGGGAAGTGTCAACTTTAACTGAA
JMSF040K03+ CCGTGGTCGGAACTGAGCCCAAGGAATCCCGGCGTGTGGGAAGTGTCAACTTTAACTGAA
JMFF012M19+ CCGTGGTCGGAACTGAGCCCAAGGAATCCCGGCGTGTGGGAAGTGTCAACTTTAACTGAA
JMFF001N06+ CCGTGGTCGGAACTGAGCCCAAGGAATCCCGGCGTGTGGGAAGTGTCAACTTTAACTGAA
JMSF005D20+ ACTGAA
JMSF026A11+ CCGTGGTCGGAACTGAGCCCAAGGAATCCCGGCGTGTGGGAAGTGTCAACTTTAACTGAA
                      ____________________________________________________________
consensus CCGTGGTCGGAACTGAGCCCAAGGAATCCCGGCGTGTGGGAAGTGTCAACTTTAACTGAA
 
. : . : . : . : . : . :
JMFS075A07+ GCATCCTTAGTGGAATACAGATATCCAGGAGATTTCTTGATGGCTTCAAGCTCTGCCGGA
JMFS090C10+ GCATCCTTAGTGGAATACAGATATCCAGGAGATTTCTTGATGGCTTCAAGCTCTGCCGGA
JMFS149H04+ GCATCCTTAGTGGAATACAGATATCCAGGAGATTTCTTGATGGCTTCAAGCTCTGCCGGA
JMSF040K03+ GCATCCTTAGTGGAATACAGATATCCAGGAGATTTCTTGATGGCTTCAAGCTCTGCCGGA
JMFF012M19+ GCATCCTTAGTGGAATACAGATATCCAGGAGATTTCTTGATGGCTTCAAGCTCTGCCGGA
JMFF001N06+ GCATCCTTAGTGGAATACAGATATCCAGGAGATTTCTTGATGGCTTCAAGCTCTGCCGGA
JMSF005D20+ GCATCCTTAGTGGAATACAGATATCCAGGAGATTTCTTGATGGCTTCAAGCTCTGCCGGA
JMSF026A11+ GCATCCTTAGTGGAATACAGATATCCAGGAGATTTCTTGATGGCTTCAAGCTCTGCCGGA
JMFS154C08+ TGATGGCTTCAAGCTCTGCCGGA
                      ____________________________________________________________
consensus GCATCCTTAGTGGAATACAGATATCCAGGAGATTTCTTGATGGCTTCAAGCTCTGCCGGA
 
. : . : . : . : . : . :
JMFS075A07+ GAAAGAACTGCACTAAAACCATGGATGGCATTAGTGTAGGCATACACAAGCCCTCTGTTT
JMFS090C10+ GAAAGAACTGCACTAAAACCATGGATGGCATTAGTGTAGGCATACACAAGCCCTCTGTTT
JMFS149H04+ GAAAGAACTGCACTAAAACCATGGATGGCATTAGTGTAGGCATACACAAGCCCTCTGTTT
JMSF040K03+ GAAAGAACTGCACTAAAACCATGGATGGCATTAGTGTAGGCATACACAAGCCCTCTGTTT
JMFF012M19+ GAAAGAACTGCACTAAAACCATGGATGGCATTAGTGTAGGCATACACAAGCCCTCTGTTT
JMFF001N06+ GAAAGAACTGCACTAAAACCATGGATGGCATTAGTGTAGGCATACACAAGCCCTCTGTTT
JMSF005D20+ GAAAGAACTGCACTAAAACCATGGATGGCATTAGTGTAGGCATACACAAGCCCTCTGTTT
JMSF026A11+ GAAAGAACTGCACTAAAACCATGGATGGCATTAGTGTAGGCATACACAAGCCCTCTGTTT
JMFS154C08+ GAAAGAACTGCACTAAAACCATGGATGGCATTAGTGTAGGCATACACAAGCCCTCTGTTT
                      ____________________________________________________________
consensus GAAAGAACTGCACTAAAACCATGGATGGCATTAGTGTAGGCATACACAAGCCCTCTGTTT
 
. : . : . : . : . : . :
JMFS075A07+ GATATAGAAGAAAGGGTAGCGGAAAACCAGCTCTGATGGCTAGTAAAAGCTCTGGGCATG
JMFS090C10+ GATATAGAAGAAAGGGTAGCGGAAAACCAGCTCTGATGGCTAGTAAAAGCTCTGGGCATG
JMFS149H04+ GATATAGAAGAAAGGGTAGCGGAAAACCAGCTCTGATGGCTAGTAAAAGCTCTGGGCATG
JMSF040K03+ GATATAGAAGAAAGGGTAGCGGAAAACCAGCTCTGATGGCTAGTAAAAGCTCTGGGCATG
JMFF012M19+ GATATAGAAGAAAGGGTAGCGGAAAACCAGCTCTGATGGCTAGTAAAAGCTCTGGGCATG
JMFF001N06+ GATATAGAAGAAAGGGTAGCGGAAAACCAGCTCTGATGGCTAGTAAAAGCTCTGGGCATG
JMSF005D20+ GATATAGAAGAAAGGGTAGCGGAAAACCAGCTCTGATGGCTAGTAAAAGCTCTGGGCATG
JMSF026A11+ GATATAGAAGAAAGGGTAGCGGAAAACCAGCTCTGATGGCTAGTAAAAGCTCTGGGCATG
JMFS154C08+ GATATAGAAGAAAGGGTAGCGGAAAACCAGCTCTGATGGCTAGTAAAAGCTCTGGGCATG
                      ____________________________________________________________
consensus GATATAGAAGAAAGGGTAGCGGAAAACCAGCTCTGATGGCTAGTAAAAGCTCTGGGCATG
 
. : . : . : . : . : . :
JMFS075A07+ AATGATAAGTCCATATGGACAATATAAGTTTCAGACTGTCCATCAATGGAGAAAATCTGC
JMFS090C10+ AATGATAAGTCCATATGGACAATATAAGTTTCAGACTGTCCATCAATGGAGAAAATCTGC
JMFS149H04+ AATGATAAGTCCATATGGACAATATAAGTTTCAGACTGTCCATCAATGGAGAAAATCTGC
JMSF040K03+ AATGATAAGTCCATATGGACAATATAAGTTTCAGACTGTCCATCAATGGAGAAAATCTGC
JMFF012M19+ AATGATAAGTCCATATGGACAATATAAGTTTCAGACTGTCCATCAATGGAGAAAATCTGC
JMFF001N06+ AATGATAAGTCCATATGGACAATATAAGTTTCAGACTGTCCATCAATGGAGAAAATCTGC
JMSF005D20+ AATGATAAGTCCATATGGACAATATAAGTTTCAGACTGTCCATCAATGGAGAAAATCTGC
JMSF026A11+ AATGATAAGTCCATATGGACAATATAAGTTTCAGACTGTCCATCAATGGAGAAAATCTGC
JMFS154C08+ AATGATAAGTCCATATGGACAATATAAGTTTCAGACTGTCCATCAATGGAGAAAATCTGC
                      ____________________________________________________________
consensus AATGATAAGTCCATATGGACAATATAAGTTTCAGACTGTCCATCAATGGAGAAAATCTGC
 
. : . : . : . : . : . :
JMFS075A07+ AGAAATGTTGCAGAGATAAATGCCAAATGGAAAAACAACGCCCTATGATTAGCCATTTCT
JMFS090C10+ AGAAATGTTGCAGAGATAAATGCCAAATGGAAAAACAACGCCCTATGATTAGCCATTTCT
JMFS149H04+ AGAAATGTTGCAGAGATAAATGCCAAATGGAAAAACAACGCCCT
JMSF040K03+ AGAAATGTTGCAGAGATAAATGCCAAATGGAAAAACAACGCCCTATGATTAGCCATTTCT
JMFF012M19+ AGAAATGTTGCAGAGATAAATGCCAAATGGAAAAACAACGCCCTATGATTAGCCATTTCT
JMFF001N06+ AGAAATGTTGCAGAGATAAATGCCAAATGGAAAAACAACGCCCTATGATTAGCCATTTCT
JMSF005D20+ AGAAATGTTGCAGAGATAAATGCCAAATGGAAAAACAACGCCCTATGATTAGCCATTTCT
JMSF026A11+ AGAAATGTTGCAGAGATAAATGCCAAATGGAAAAACAACGCCCTATGATTAGCCATTTCT
JMFS154C08+ AGAAATGTTGCAGAGATAAATGCCAAATGGAAAAACAACGCCCTATGATTAGCCATTTCT
                      ____________________________________________________________
consensus AGAAATGTTGCAGAGATAAATGCCAAATGGAAAAACAACGCCCTATGATTAGCCATTTCT
 
. : . : . : . : . : . :
JMFS075A07+ TAGGCCAA
JMFS090C10+ TAGGC
JMSF040K03+ TAGGCCAATATACTAAATTAGGATGGGAT
JMFF012M19+ TAGGCCAATATACTAAATTAGGATGGGATATTTC
JMFF001N06+ TAGGCCAATATACTAAATTAGGATGGGATATTTC
JMSF005D20+ TAGGCCAATATACTAAATTAGGATGGGATATTTC
JMSF026A11+ TAGGCCAATATACTAAATTAGGATGGGATATTTCTTCTCTAACTTATGGCAGTTTACTTA
JMFS154C08+ TAGGCCAATATACTAAATTAGGATGGGATATTTCTTCTCTAACTTATGGCAGTTTACTTA
                      ____________________________________________________________
consensus TAGGCCAATATACTAAATTAGGATGGGATATTTCTTCTCTAACTTATGGCAGTTTACTTA
 
. : . : . : . : . : . :
JMSF026A11+ TATAGAGGAATTGAAC
JMFS154C08+ TATAGAGGAATTGAACAAGCTAAGGCATGGGAAACTTCTGCATTATATTCCAACTTGTGA
                      ____________________________________________________________
consensus TATAGAGGAATTGAACAAGCTAAGGCATGGGAAACTTCTGCATTATATTCCAACTTGTGA
 
. : . : . : . : . : . :
JMFS154C08+ TTTACTTTGTCCATTTCTTATACCAGATTGGGGGACCCTTAGCTTTAATCCACTAATTGC
                      ____________________________________________________________
consensus TTTACTTTGTCCATTTCTTATACCAGATTGGGGGACCCTTAGCTTTAATCCACTAATTGC
 
. : . : . : . : . : . :
JMFS154C08+ AAGCTAGCTAGGTTGCAACAATTTCAAATCTGCAGCAAATTAAACTTTTTTTGCCATTGA
                      ____________________________________________________________
consensus AAGCTAGCTAGGTTGCAACAATTTCAAATCTGCAGCAAATTAAACTTTTTTTGCCATTGA
 
. : . : . : . : . : . :
JMFS154C08+ CGTACTGCCCATCTCTCTGTGAATGTCATCTTTACATTGAGGCAAATAAATAAAGACAAC
                      ____________________________________________________________
consensus CGTACTGCCCATCTCTCTGTGAATGTCATCTTTACATTGAGGCAAATAAATAAAGACAAC
 
. : . : . : . : . : . :
JMFS154C08+ CGCCAATTATGCAGCCGACTTTCAATCATGGAGACTATTGCAAAAAATGGATTATATGGT
                      ____________________________________________________________
consensus CGCCAATTATGCAGCCGACTTTCAATCATGGAGACTATTGCAAAAAATGGATTATATGGT