Previous Contig 004144:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014F15Sequence601000744 (4)751004144 (3)gb:AP003350_18285462e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070
JMFS153E11Sequence251004144 (3)
JMSF034G07Sequence638019799pir|T52396|T523961e-30formin-binding protein homolog [imported] - Arabidopsis thaliana>gb:AP000417_182745004144 (3)gb:AP003350_18285468e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P070

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF034G07+ AGATGATGAAAGATGCTCGCGCCTTGNAAAAAT
                      ____________________________________________________________
consensus AGATGATGAAAGATGCTCGCGCCTTGNAAAAAT
 
. : . : . : . : . : . :
rJMSF034G07+ TGATCGCTTGGAGGTTTTCCAGGAATATATTCGTGACTTGGAGAAGGAAGAGGAAGAGCA
                      ____________________________________________________________
consensus TGATCGCTTGGAGGTTTTCCAGGAATATATTCGTGACTTGGAGAAGGAAGAGGAAGAGCA
 
. : . : . : . : . : . :
rJMSF034G07+ ACGGAAAACACAAAAGGAACAATTGAGACGTGCTGAGCGCAAGAACCGTGATGCTTTTCG
                      ____________________________________________________________
consensus ACGGAAAACACAAAAGGAACAATTGAGACGTGCTGAGCGCAAGAACCGTGATGCTTTTCG
 
. : . : . : . : . : . :
rJMSF034G07+ TAATATGATGGAAGACCATATTGCTGCTGGCACAGTCACTGCTAAAACACTATGGCGTGA
                      ____________________________________________________________
consensus TAATATGATGGAAGACCATATTGCTGCTGGCACAGTCACTGCTAAAACACTATGGCGTGA
 
. : . : . : . : . : . :
rJMSF034G07+ CTATTGTCCAATGGTGAAGGAGTCCGTGGCTTATCAGGCTGTTGCATCCAACACTTCAGG
                      ____________________________________________________________
consensus CTATTGTCCAATGGTGAAGGAGTCCGTGGCTTATCAGGCTGTTGCATCCAACACTTCAGG
 
. : . : . : . : . : . :
rJMSF034G07+ TTCTACACCAAAGGATTTGTTTGAAGATGTTGTGGAAGAGTTGGAAAATCAGTATCATGA
                      ____________________________________________________________
consensus TTCTACACCAAAGGATTTGTTTGAAGATGTTGTGGAAGAGTTGGAAAATCAGTATCATGA
 
. : . : . : . : . : . :
rJMSF034G07+ AGACAAAACACGTGTTAAAAATGTCTTGAAGTCAGAAAAGATAACATTCTCACCATTATG
                      ____________________________________________________________
consensus AGACAAAACACGTGTTAAAAATGTCTTGAAGTCAGAAAAGATAACATTCTCACCATTATG
 
. : . : . : . : . : . :
rJMSF034G07+ GTCATTTGAGGACTTTAAAGCTGCTATTCTGGAAACCATTGGTACCCCATCCATTTCTGA
                      ____________________________________________________________
consensus GTCATTTGAGGACTTTAAAGCTGCTATTCTGGAAACCATTGGTACCCCATCCATTTCTGA
 
. : . : . : . : . : . :
rJMSF034G07+ GGTTAATTTGCAGCTCATTTTTGAGGACCTCATGGAGAGAGCCAAGGATAAGGAGGAGAA
                      ____________________________________________________________
consensus GGTTAATTTGCAGCTCATTTTTGAGGACCTCATGGAGAGAGCCAAGGATAAGGAGGAGAA
 
. : . : . : . : . : . :
rJMSF034G07+ AGAAGCTAAAAAGCGTCAACGGCTTGCAAAAGATTTTGTTGAGATGCTGAGCAATGCTGA
                      ____________________________________________________________
consensus AGAAGCTAAAAAGCGTCAACGGCTTGCAAAAGATTTTGTTGAGATGCTGAGCAATGCTGA
 
. : . : . : . : . : . :
rJMSF034G07+ TGAAATAACTGCTGCTTCTAGTTGGGAGGAATGCAAAGAGCTTGTGGAGGATAGCTCAGA
rJMFF014F15+ GAATGCAAAGAGCTTGTGGAGGATAGCTCAGA
                      ____________________________________________________________
consensus TGAAATAACTGCTGCTTCTAGTTGGGAGGAATGCAAAGAGCTTGTGGAGGATAGCTCAGA
 
. : . : . : . : . : . :
rJMSF034G07+ ATACAAAGCTATTGGAGAAGAGACAACCTTGAGGGAAATCTTTGAGGAATATGTTACTCG
rJMFF014F15+ ATCCAAAGCTATTGGAGAAGAGACAACCTTGAGGGAAATCTTTGAGGAATATGTTACTCG
                      ____________________________________________________________
consensus ATCCAAAGCTATTGGAGAAGAGACAACCTTGAGGGAAATCTTTGAGGAATATGTTACTCG
 
. : . : . : . : . : . :
rJMSF034G07+ CTTGCAGGAGAAGGCAAAAGAAAAGGAACGCAGACGAGAGGAGGAAAAGGCT
rJMFF014F15+ CTTGCAGGAGAAGGCAAAAGAAAAGGAACGCAGACGAGAGGAGGAAAAGGCTAAAAAGGA
                      ____________________________________________________________
consensus CTTGCAGGAGAAGGCAAAAGAAAAGGAACGCAGACGAGAGGAGGAAAAGGCTAAAAAGGA
 
. : . : . : . : . : . :
rJMFF014F15+ TAAGGAAAAAGAGGAGAAAGAAAAGAGAAAAGATAAAGAGAGAAAAGAGAAGGACAAGGA
                      ____________________________________________________________
consensus TAAGGAAAAAGAGGAGAAAGAAAAGAGAAAAGATAAAGAGAGAAAAGAGAAGGACAAGGA
 
. : . : . : . : . : . :
rJMFF014F15+ GAAGGAAGAGCAGCGTGAGAGAGAAAAGGAGAAGGGAAAAGAACGTTCGAGAAAGGATGA
                      ____________________________________________________________
consensus GAAGGAAGAGCAGCGTGAGAGAGAAAAGGAGAAGGGAAAAGAACGTTCGAGAAAGGATGA
 
. : . : . : . : . : . :
rJMFF014F15+ TGCTGATAGTGAGAGTGTAGATTTCGTTGAATATGAACACAAAGAAGATAAAAAGAGGGA
                      ____________________________________________________________
consensus TGCTGATAGTGAGAGTGTAGATTTCGTTGAATATGAACACAAAGAAGATAAAAAGAGGGA
 
. : . : . : . : . : . :
rJMFF014F15+ TAAGGACAAAGATAGGAAACATCGGAAACGGCATCATAGCTCTACTGATGATGTGACTTC
                      ____________________________________________________________
consensus TAAGGACAAAGATAGGAAACATCGGAAACGGCATCATAGCTCTACTGATGATGTGACTTC
 
. : . : . : . : . : . :
rJMFF014F15+ TGATAAGGATGAGAAAGAGGAAACTAAGAAGTCCCGTCGACATAGTGGTGAACGGAAGAA
                      ____________________________________________________________
consensus TGATAAGGATGAGAAAGAGGAAACTAAGAAGTCCCGTCGACATAGTGGTGAACGGAAGAA
 
. : . : . : . : . : . :
rJMFF014F15+ GTCAAAGAAGCATGCACATTCACCTGAATCAGACGGTGAAAGTCGACGCAAGAGACACAA
                      ____________________________________________________________
consensus GTCAAAGAAGCATGCACATTCACCTGAATCAGACGGTGAAAGTCGACGCAAGAGACACAA
 
. : . : . : . : . : . :
rJMFF014F15+ AAAAGAACGCGATGCATCTCGTCGTAGTGGTGGATACGAAGAGCTGGAAGATGGTGAACT
JMFS153E11- GATGGTGAACT
                      ____________________________________________________________
consensus AAAAGAACGCGATGCATCTCGTCGTAGTGGTGGATACGAAGAGCTGGAAGATGGTGAACT
 
. : . : . : . : . : . :
rJMFF014F15+ CGGTGAGGATGGTGAAATTCAGTAGTGCTTTTTGTTTTGTGCATTAGTGCTTTCTTACTA
JMFS153E11- CGGTGAGGATGGTGAAATTCAGTAGTGCTTTTTGTTTTGTGCATTAGTGCTTTCTTACTA
                      ____________________________________________________________
consensus CGGTGAGGATGGTGAAATTCAGTAGTGCTTTTTGTTTTGTGCATTAGTGCTTTCTTACTA
 
. : . : . : . : . : . :
rJMFF014F15+ GAACTCTTCATAGCCTAGTACACTATTTTACTGCAAGATTTTGTCTATGATTTTTTAGTC
JMFS153E11- GAACTCTTCATAGCCTAGTACACTATTTTACTGCAAGATTTTGTCTATGATTTTTTAGTC
                      ____________________________________________________________
consensus GAACTCTTCATAGCCTAGTACACTATTTTACTGCAAGATTTTGTCTATGATTTTTTAGTC
 
. : . : . : . : . : . :
rJMFF014F15+ GCATCTAACAACACTATGATGTAACCTGTGTCGGTACCGAGTAGTGTTTTGTTATACAC
JMFS153E11- GCATCTAACAACACTATGATGTAACCTGTGTCGGTACCGAGTAGTGTTTTGTTATACACT
                      ____________________________________________________________
consensus GCATCTAACAACACTATGATGTAACCTGTGTCGGTACCGAGTAGTGTTTTGTTATACACT
 
. : . : . : . : . : . :
JMFS153E11- GGTGTAGATTGCCGCTGCAAATGCTATTTTCATCATGAAAAAGATGAGCTGTTACTATAC
                      ____________________________________________________________
consensus GGTGTAGATTGCCGCTGCAAATGCTATTTTCATCATGAAAAAGATGAGCTGTTACTATAC