Previous Contig 004141:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006M24Sequence564004314 (12)gb:AY090553_15741592e-23Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.708004141 (11)gb:AY090553_15741592e-56Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.
JMFF007E20Sequence550004314 (12)gb:AY090553_15741593e-20Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.741004141 (11)gb:AY090553_15741593e-57Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.
JMFF011H17Sequence586004314 (12)gb:AY090553_15741591e-26Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.755004141 (11)gb:AY090553_15741591e-60Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.
JMFF026C18Sequence543004314 (12)gb:AY090553_15741593e-20Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.770004141 (11)gb:AY090553_15741592e-52Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.
JMFF027B11Sequence544014607gb:AY090553_15741593e-20Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.770004141 (11)gb:AY090553_15741591e-60Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.
JMFF034H24Sequence601004314 (12)gb:AB010075_15109793e-24Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MPA24.533004141 (11)gb:AY090553_15741592e-25Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.
JMFS153D11Sequence144004141 (11)
JMSF001F19Sequence424004314 (12)gb:AY098938_15765020.002Solanum tuberosum Aux/IAA protein mRNA, complete cds.775004141 (11)gb:AY090553_15741596e-69Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.
JMSF002F19Sequence425004314 (12)gb:AY098938_15765020.002Solanum tuberosum Aux/IAA protein mRNA, complete cds.731004141 (11)gb:AY090553_15741592e-68Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.
JMSF034A07Sequence676004314 (12)gb:AY090553_15741593e-22Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.758004141 (11)gb:AY090553_15741592e-67Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.
JMSF050C10Sequence675004314 (12)gb:AY090553_15741594e-30Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.772004141 (11)gb:AY090553_15741591e-82Zinnia elegans auxin-regulated protein (IAA8) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF050C10+ CTAACAATGCCATCAATCCACCCGCTGCTA
                      ____________________________________________________________
consensus CTAACAATGCCATCAATCCACCCGCTGCTA
 
. : . : . : . : . : . :
rJMSF050C10+ AGGCACAAGTTGTTGGTTGGCCACCTATTAGATCGTTTAGGAAGAATGCACTGACCTCCA
rJMSF001F19+ ACTGACCTCCA
                      ____________________________________________________________
consensus AGGCACAAGTTGTTGGTTGGCCACCTATTAGATCGTTTAGGAAGAATGCACTGACCTCCA
 
. : . : . : . : . : . :
rJMSF050C10+ CCTCAAAGGTTAATGATGAAGTTGATGGAAAACCGGGCCCTGGGGCTCTTTTTGTTAAAG
rJMSF034A07+ AGGTTAATGATGAAGTTGATGGAAAACCGGGCCCTGGGGCTCTTTTTGTTAAAG
rJMSF002F19+ AGGTTAATGATGAAGTTGATGGAAAACCGGGCCCTGGGGCTCTTTTTGTTAAAG
rJMSF001F19+ CCTCAAAGGTTAATGATGAAGTTGATGGAAAACCGGGCCCTGGGGCTCTTTTTGTTAAAG
rJMFF007E20+ G
rJMFF011H17+ GGGGCTCTTTTTGTTAAAG
rJMFF027B11+ TGGGGCTCTTTTTGTTAAAG
rJMFF026C18+ GGCTCTTTTTGTTAAAG
                      ____________________________________________________________
consensus CCTCAAAGGTTAATGATGAAGTTGATGGAAAACCGGGCCCTGGGGCTCTTTTTGTTAAAG
 
. : . : . : . : . : . :
rJMSF050C10+ TGAGCATGGATGGAGCTCCGTATCTAA-GGAAGGTGGATCTTAGAA-CTTACGCCTCATA
rJMSF034A07+ TGAGCATGGATGGAGCTCCGTATCTAA-GGAAGGTGGATCTTAGAA-CTTACGCCTCATA
rJMSF002F19+ TGAGCATGGATGGAGCTCCGTATCTAA-GGAAGGTGGATCTTAGAA-CTTACGCCTCATA
rJMSF001F19+ TGAGCATGGATGGAGCTCCGTATCTAA-GGAAGGTGGATCTTAGAA-CTTACGCCTCATA
rJMFF007E20+ TGAGCATGGATGGAGCTCCGTATCTAA-GGAAGGTGGATCTTAGAA-CTTACGCNTCATA
rJMFF011H17+ TGAGCATGGATGGAGCTCCGTATCTAA-GGAAGGTGGATCTTAGAA-CTTACGCCTCATA
rJMFF006M24+ GCATGGATGGAGCTCCGTATCTAA-GGAAGGTGGATCTTAGAA-CTTACGCCTCATA
rJMFF027B11+ TGAGCATGGATGGAGCTCCGTATCTAA-GGAAGGTGGATCTTAGAA-CTTACGCCTCATA
rJMFF026C18+ TGAGCATGGATGGAGCTCCGTATCTAAGGGAAGGTGGATCTTAGAANCTTACGCCTCATA
                      ____________________________________________________________
consensus TGAGCATGGATGGAGCTCCGTATCTAA-GGAAGGTGGATCTTAGAA-CTTACGCCTCATA
 
. : . : . : . : . : . :
rJMSF050C10+ TCAAGAACTTTCTTCTGCACTTGAGAAGATGTTCAGTTGCTTTACCATAGGACAATGTGG
rJMSF034A07+ TCAAGAACTTTCTTCTGCACTTGAGAAGATGTTCAGTTGCTTTACCATAGGACAATGTGG
rJMSF002F19+ TCAAGAACTTTCTTCTGCACTTGAGAAGATGTTCAGTTGCTTTACCATAGGACAATGTGG
rJMSF001F19+ TCAAGAACTTTCTTCTGCACTTGAGAAGATGTTCAGTTGCTTTACCATAGGACAATGTGG
rJMFF007E20+ TCAAGAACTTTCTTCTGCACTTGAGAAGATGTTCAGTTGCTTTACCATAGGACAATGTGG
rJMFF011H17+ TCAAGAACTTTCTTCTGCACTTGAGAAGATGTTCAGTTGCTTTACCATAGGACAATGTGG
rJMFF006M24+ TCAAGAACTTTCTTCTGCACTTGAGAAGATGTTCAGTTGCTTTACCATAGGACAATGTGG
rJMFF027B11+ TCAAGAACTTTCTTCTGCACTTGAGAAGATGTTCAGTTGCTTTACCATAGGACAATGTGG
rJMFF026C18+ TCAAGAACTTTCTTCTGCACTTGAGAAGATGTTCAGTTGCTTTACCATAGGACAATGTGG
                      ____________________________________________________________
consensus TCAAGAACTTTCTTCTGCACTTGAGAAGATGTTCAGTTGCTTTACCATAGGACAATGTGG
 
. : . : . : . : . : . :
rJMSF050C10+ ATCCCAAGGAGCTCCGGGCAGAGAAAATTTGAGTGAAAGCAAGTTAAGAGATTTCCTTCA
rJMSF034A07+ ATCCCAAGGAGCTCCGGGCAGAGAAAATTTGAGTGAAAGCAAGTTAAGAGATTTCCTTCA
rJMSF002F19+ ATCCCAAGGAGCTCCGGGCAGAGAAAATTTGAGTGAAAGCAAGTTAAGAGATTTCCTTCA
rJMSF001F19+ ATCCCAAGGAGCTCCGGGCAGAGAAAATTTGAGTGAAAGCAAGTTAAGAGATTTCCTTCA
rJMFF007E20+ ATCCCAAGGAGCTCCGGGCAGAGAAAATTTGAGTGAAAGCAAGTTAAGAGATTTCCTTCA
rJMFF011H17+ ATCCCAAGGAGCTCCGGGCAGAGAAAATTTGAGTGAAAGCAAGTTAAGAGATTTCCTTCA
rJMFF034H24+ TCCTTCA
rJMFF006M24+ ATCCCAAGGAGCTCCGGGCAGAGAAAATTTGAGTGAAAGCAAGTTAAGAGATTTCCTTCA
rJMFF027B11+ ATCCCAAGGAGCTCCGGGCAGAGAAAATTTGAGTGAAAGCAAGTTAAGAGATTTCCTTCA
rJMFF026C18+ ATCCCAAGGAGCTCCGGGCAGAGAAAATTTGAGTGAAAGCAAGTTAAGAGATTTCCTTCA
                      ____________________________________________________________
consensus ATCCCAAGGAGCTCCGGGCAGAGAAAATTTGAGTGAAAGCAAGTTAAGAGATTTCCTTCA
 
. : . : . : . : . : . :
rJMSF050C10+ TGGATCAGAATATGTGCTTACATATGAGGATAAGGATGGTGATTGGATGCTTGTGGGAGA
rJMSF034A07+ TGGATCAGAATATGTGCTTACATATGAGGATAAGGATGGTGATTGGATGCTTGTGGGAGA
rJMSF002F19+ TGGATCAGAATATGTGCTTACATATGAGGATAAGGATGGTGATTGGATGCTTGTGGGAGA
rJMSF001F19+ TGGATCAGAATATGTGCTTACATATGAGGATAAGGATGGTGATTGGATGCTTGTGGGAGA
rJMFF007E20+ TGGATCAGAATATGTGCTTACATATGAGGATAAGGATGGTGATTGGATGCTTGTGGGAGA
rJMFF011H17+ TGGATCAGAATATGTGCTTACATATGAGGATAAGGATGGTGATTGGATGCTTGTGGGAGA
rJMFF034H24+ TGGATCAGAATATGTGCTTACATATGAGGATAAGGATGGTGATTGGATGCTTGNGGGAGA
rJMFF006M24+ TGGATCAGAATATGTGCTTACATATGAGGATAAGGATGGTGATTGGATGCTTGTGGGAGA
rJMFF027B11+ TGGATCAGAATATGTGCTTACATATGAGGATAAGGATGGTGATTGGATGCTTGTGGGAGA
rJMFF026C18+ TGGATCAGAATATGTGCTTACATATGAGGATAAGGATGGTGATTGGATGCTTGTGGGAGA
                      ____________________________________________________________
consensus TGGATCAGAATATGTGCTTACATATGAGGATAAGGATGGTGATTGGATGCTTGTGGGAGA
 
. : . : . : . : . : . :
rJMSF050C10+ TGTCCCATGGGACATGTTTATCGAGTCCTGCAAGCGATTGAAGATCATGAAAGGCTCTGA
rJMSF034A07+ TGTCCCATGGGACATGTTTATCGAGTCCTGCAAGCGATTGAAGATCATGAAAGGCTCTGA
rJMSF002F19+ TGTCCCATGGGACATGTTTATCGAGTCCTGCAAGCGATTGAAGATCATGAAAGGCTCTGA
rJMSF001F19+ TGTCCCATGGGACATGTTTATCGAGTCCTGCAAGCGATTGAAGATCATGAAAGGCTCTGA
rJMFF007E20+ TGTCCCATGGGACATGTTTATCGAGTCCTGCAAGCGATTGAAGATCATGAAAGGCTCTGA
rJMFF011H17+ TGTCCCATGGGACATGTTTATCGAGTCCTGCAAGCGATTGAAGATCATGAAAGGCTCTGA
rJMFF034H24+ TGTCCCATGGGACATGTTTATCGAGTCCTGCAAGCGATTGAAGATCATGAAAGGCTCTGA
rJMFF006M24+ TGTCCCATGGGACATGTTTATCGAGTCCTGCAAGCGATTGAAGATCATGAAAGGCTCTGA
rJMFF027B11+ TGTCCCATGGGACATGTTTATCGAGTCCTGCAAGCGATTGAAGATCATGAAAGGCTCTGA
rJMFF026C18+ TGTCCCATGGGACATGTTTATCGAGTCCTGCAAGCGATTGAAGATCATGAAAGGCTCTGA
                      ____________________________________________________________
consensus TGTCCCATGGGACATGTTTATCGAGTCCTGCAAGCGATTGAAGATCATGAAAGGCTCTGA
 
. : . : . : . : . : . :
rJMSF050C10+ TGCTATTGGATTAGCTCCCAGGGCGAAGGAGAAATCCAAGAGCAGGAACTAGCTCCTGCT
rJMSF034A07+ TGCTATTGGATTAGCTCCCAGGGCGAAGGAGAAATCCAAGAGCAGGAACTAGCTCCTGCT
rJMSF002F19+ TGCTATTGGATTAGCTCCCAGGGCGAAGGAGAAATCCAAGAGCAGGAACTAGCTCCTGCT
rJMSF001F19+ TGCTATTGGATTAGCTCCCAGGGCGAAGGAGAAATCCAAGAGCAGGAACTAGCTCCTGCT
rJMFF007E20+ TGCTATTGGATTAGCTCCCAGGGCGAAGGAGAAATCCAAGAGCAGGAACTAGCTCCTGCT
rJMFF011H17+ TGCTATTGGATTAGCTCCCAGGGCGAAGGAGAAATCCAAGAGCAGGAACTAGCTCCTGCT
rJMFF034H24+ TGCTATTGGATTAGCTCCCAGGGCGAAGGAGAAATCCAAGAGCAGGAACTAGCTCCTGCT
rJMFF006M24+ TGCTATTGGATTAGCTCCCAGGGCGAAGGAGAAATCCAAGAGCAGGAACTAGCTCCTGCT
rJMFF027B11+ TGCTATTGGATTAGCTCCCAGGGCGAAGGAGAAATCCAAGAGCAGGAACTAGCTCCTGCT
rJMFF026C18+ TGCTATTGGATTAGCTCCCAGGGCGAAGGAGAAATCCAAGAGCAGGAACTAGCTCCTGCT
                      ____________________________________________________________
consensus TGCTATTGGATTAGCTCCCAGGGCGAAGGAGAAATCCAAGAGCAGGAACTAGCTCCTGCT
 
. : . : . : . : . : . :
rJMSF050C10+ CGGGCAAAGTGACAGCTTCTCGAAACCCCCCAGCAAATTGCAAGAGTAGAGAAGTGAGCG
rJMSF034A07+ CGGGCAAAGTGACAGCTTCTCGAAACCCCCCAGCAAATTGCAAGAGTAGAGAAGTGAGCG
rJMSF002F19+ CGGGCAAAGTGACAGCTTCTCGAAACCCCCCAGCAAATTGCAAGAGTAGAGAAGTGAGCG
rJMSF001F19+ CGGGCAAAGTGACAGCTTCTCGAAACCCCCCAGCAAATTGCAAGAGTAGAGAAGTGAGCG
rJMFF007E20+ CGGGCAAAGTGACAGCTTCTCGAAACCCCCCAGCAAATTGCAAGAGTAGAGAAGTGAGCG
rJMFF011H17+ CGGGCAAAGTGACAGCTTCTCGAAACCCCCCAGCAAATTGCAAGAGTAGAGAAGTGAGCG
rJMFF034H24+ CGGGCAAAGTGACAGCTTCTCGAAACCCCCCAGCAAATTGCAAGAGTAGAGAAGTGAGCG
rJMFF006M24+ CGGGCAAAGTGACAGCTTCTCGAAACCCCCCAGCAAATTGCAAGAGTAGAGAAGTGAGCG
rJMFF027B11+ CGGGCAAAGTGACAGCTTCTCGAAACCCCCCAGCAAATTGCAAGAGTAGAGAAGTGAGCG
rJMFF026C18+ CGGGCAAAGTGACAGCTTCTCGAAACCCCCCAGCAAATTGCAAGAGTAGAGAAGTGAGCG
                      ____________________________________________________________
consensus CGGGCAAAGTGACAGCTTCTCGAAACCCCCCAGCAAATTGCAAGAGTAGAGAAGTGAGCG
 
. : . : . : . : . : . :
rJMSF050C10+ AGGATTTGTGATGAGGAATGAAAAGC-GGATGGTTTGGAGAGTGGAGTATAGAGCCTTTG
rJMSF034A07+ AGGATTTGTGATGAGGAATGAAAAGC-GGATGGTTTGGAGAGTGGAGTATAGAGCCTTTG
rJMSF002F19+ AGGATTTGTGATGAGGAATGAAAAGC-GGATGGTTTGGAGAGTGGAGTATAGAGCCTTTG
rJMSF001F19+ AGGATTTGTGATGAGGAATGAAAAGC-GGATGGTTTGGAGAGTGGAGTATAGAGCCTTTG
rJMFF007E20+ AGGATTTGTGATGAGGAATGAAAAGC-GGATGGTTTGGAGAGTGGAGTATAGAGCCTTTG
rJMFF011H17+ AGGATTTGTGATGAGGAATGAAAAGCNNGATGGTTTGGAGAGTGGAGTATAGANCCTTTG
rJMFF034H24+ AGGATTTGTGATGAGGAATGAAAAGC-GGATGGTTTGGAGAGTGGAGTATAGAGCCTTTG
rJMFF006M24+ AGGATTTGTGATGAGGAATGAAAAGC-GGATGGTTTGGAGAGTGGAGTATAGAGCCTTTG
rJMFF027B11+ AGGATTTGTGATGAGGAATGAAAAGC-GGATGGTTTGGAGAGTGGAGTATAGAGCCTTTG
rJMFF026C18+ AGGATTTGTGATGAGGAATGAAAAGC-GGATGGTTTGGAGAGTGGAGTATAGAGCCTTTG
                      ____________________________________________________________
consensus AGGATTTGTGATGAGGAATGAAAAGC-GGATGGTTTGGAGAGTGGAGTATAGAGCCTTTG
 
. : . : . : . : . : . :
rJMSF050C10+ GTGTTCCTGTCCATGCATCATCGACTACCAAGATGGACATAAATCTCTGTTTGTTCGTTC
rJMSF034A07+ GTGTTCCTGTCCATGCATCATCGACTACCAAGATGGACATAAATCTCTGTTTGTTCGTTC
rJMSF002F19+ GTGTTCCTGTCCATGCATCATCGACTACCAAGATGGACATAAATCTCTGTTTGTTCGTTC
rJMSF001F19+ GTGTTCCTGTCCATGCATCATCGACTACCAAGATGGACATAAATCTCTGTTTGTTCGTTC
rJMFF007E20+ GTGTTCCTGTCCATGCATCATCGACTACCAAGATGGACATAAATCTCTGTTTGTTCGTTC
rJMFF011H17+ GTGTTCCTGTCCATGCATCATCGACTACCAAGATGGACATAAATCTCTGTTTGTTCGTTC
rJMFF034H24+ GTGTTCCTGTCCATGCATCATCGACTACCAAGATGGACATAAATCTCTGTTTGTTCGTTC
rJMFF006M24+ GTGTTCCTGTCCATGCATCATCGACTACCAAGATGGACATAAATCTCTGTTTGTTCGTTC
rJMFF027B11+ GTGTTCCTGTCCATGCATCATCGACTACCAAGATGGACATAAATCTCTGTTTGTTCGTTC
rJMFF026C18+ GTGTTCCTGTCCATGCATCATCGACTACCAAGATGGACATAAATCTCTGTTTGTTCGTTC
                      ____________________________________________________________
consensus GTGTTCCTGTCCATGCATCATCGACTACCAAGATGGACATAAATCTCTGTTTGTTCGTTC
 
. : . : . : . : . : . :
rJMSF050C10+ CCGAGTCTGATTTATTTTAGTATCTTGTTGCGTTACTGAGAAGGTGTTTTCGTAATTAAT
rJMSF034A07+ CCGAGTCTGATTTATTTTAGTATCTTGTTGCGTT-CTGAGAAGGTGTCTTCGTAATTAAT
rJMSF002F19+ CCGAGTCTGATTTATTTTAGTATCTTGTTGCGTTACTGAGAAGGTGTCTTCGTAATTAAT
rJMSF001F19+ CCGAGTCTGATTTATTTTAGTATCTTGTTGCGTTACTGAGAAGGTGTCTTCGTAATTAAT
rJMFF007E20+ CCGAGTCTGATTTATTTTAGTATCTTGTTGCGTTACTGAGAAGGTGTCTTCGTAATTAAT
rJMFF011H17+ CCGAGTCTGATTTATTTTAGTATCTTGTTGCGTTACTGAGAAGGTGTCTTCGTAATTAAT
rJMFF034H24+ CCGAGTNTGATTTATTTTAGTATCTTGTTGCGTTACTGAGAAGGTGTCTTCGTAATTAAT
rJMFF006M24+ CCGAGTCTGATTTATTTTAGTATCTTGTTGCGTTACTGAGAAGGTGTCTTCGTAATTAAT
rJMFF027B11+ CCGAGTCTGATTTATTTTAGTATCTTGTTGCGTTACTGAGAAGGTGTCTTCGTAATTAAT
rJMFF026C18+ CCGAGTCTGATTTATTTTAGTATCTTGTTGCGTTACTGAGAAGGTGTCTTCGTAATTAAT
                      ____________________________________________________________
consensus CCGAGTCTGATTTATTTTAGTATCTTGTTGCGTTACTGAGAAGGTGTCTTCGTAATTAAT
 
. : . : . : . : . : . :
rJMSF050C10+ ACGTCTGTATTGGAACACACTTTAT
rJMSF034A07+ ACGTCTGTATTGGAACACACTTTATGTATGAAGTGGTTTGAACAATGACCATGTGATTAG
rJMSF002F19+ ACGTCTGTATTGGAACACACTTTATGTATGAAGTGGTTTGAACAATGA-CATGTGATTAG
rJMSF001F19+ ACGTCTGTATTGGAACACACTTTATGTATGAAGTGGTTTGAACAATGA-CATGTGATTAG
rJMFF007E20+ ACGTCTGTATTGGAACACACTTTATGTATGAAGTGGTTTGAACAATGA-CATGTGATTAG
rJMFF011H17+ ACGTCTGTATTGGAACACACTTTATGTATGAAGTGGTTTGAACAATGA-CATGTGATTAG
rJMFF034H24+ ACGTCNGTATTGGAACACACTTTATGTATGAAGTGGTTTGAACAATGA-CATGTGATTAG
rJMFF006M24+ ACGTCTGTATTGGAACACACTTTATGTATGAAGTGGTTTGAACAATGA-CATGTGATTAG
rJMFF027B11+ ACGTCTGTATTGGAACACACTTTATGTATGAAGTGGTTTGAACAATGA-CATGTGATTAG
rJMFF026C18+ ACGTCTGTATTGGAACACACTTTATGTATGAAGTGGTTTGAACAATGA-CATGTGATTAG
JMFS153D11+ GTTTGAACAATGA-CATGTGATTAG
                      ____________________________________________________________
consensus ACGTCTGTATTGGAACACACTTTATGTATGAAGTGGTTTGAACAATGA-CATGTGATTAG
 
. : . : . : . : . : . :
rJMSF034A07+ GAGACTTTGTAGCAATGTGCTATGTGGTTTGTTGGTTATGTCTGCTGT
rJMSF002F19+ GAGACTTTGTAGCAA
rJMSF001F19+ GAGACTTTGTAGCAATGTGCTATGTGGTTTGTTGGTTATGTCTGCTGT
rJMFF007E20+ GAGACTTTGTAGCAATGTGCTATGTGGTTTGTTGGTTATGTCTGCTGTTTATGGTTGTGA
rJMFF011H17+ GAGACTTTGTAGCAATGTGCTATGTGGTTTGTTGGTTATGTCTGCTGTTTATGGTTGTGA
rJMFF034H24+ GAGACTTTGTAGCAATGTGCTATGTGGTTTGTTGGTTATGTCTGCTGT
rJMFF006M24+ GAGACTTTGTAGCAATGTGCTATGTGGTTTGTTGGTTATGTCTGCTGTTTATGGT
rJMFF027B11+ GAGACTTTGTAGCAATGTGCTATGTGGTTTGTTGGTTATGTCTGCTGTTTATGGTTGTGA
rJMFF026C18+ GAGACTTTGTAGCAATGTGCTATGTGGTTTGTTGGTTATGTCTGCTGTTTATGGTTGTGA
JMFS153D11+ GAGACTTTGTAGCAATGTGCTATGTGGTTTGTTGGTTATGTCTGCTGTTTATGGTTGTGA
                      ____________________________________________________________
consensus GAGACTTTGTAGCAATGTGCTATGTGGTTTGTTGGTTATGTCTGCTGTTTATGGTTGTGA
 
. : . : . : . : . : . :
rJMFF007E20+ ATGTTGAATGTGAACCAAAGTTTA
rJMFF011H17+ ATGTTGAATG-GAACCAAAG
rJMFF027B11+ ATGTTGAATGTGAACCAAAGTTTATAGCAA
rJMFF026C18+ ATGTTGAATGTGAACCAAAGTTTATAGCAA
JMFS153D11+ ATGTTGAATGTGAACCAAAGTTTATAGCAAAAAAAAAAAAAAAAAACTCGAGACTAGTTC
                      ____________________________________________________________
consensus ATGTTGAATGTGAACCAAAGTTTATAGCAAAAAAAAAAAAAAAAAACTCGAGACTAGTTC