Previous Contig 004139:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS001A08Sequence593004139 (2)gb:STU52079_17231022e-72Solanum tuberosum P-glycoprotein (pmdr1) mRNA, complete cds.
JMFS153C12Sequence617004139 (2)gb:STU52079_17231021e-79Solanum tuberosum P-glycoprotein (pmdr1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS001A08+ CAGGACATATGCAAAGAATGCACTAAGAGAACCACAGATGACAGAGCCAATG
JMFS153C12+ AGATGACAGAGCCAATG
                      ____________________________________________________________
consensus CAGGACATATGCAAAGAATGCACTAAGAGAACCACAGATGACAGAGCCAATG
 
. : . : . : . : . : . :
JMFS001A08+ GAGCCAACTAAAGCGTAAGCCCACTCAGGAGAGTTCATCTTCGCAAGGCGCCAGAAGGAA
JMFS153C12+ GAGCCAACTANAGCGTAAGCCCACTCAGGAGAGTTCATCTTCGCAAGGCGCCAGAAGGAA
                      ____________________________________________________________
consensus GAGCCAACTAAAGCGTAAGCCCACTCAGGAGAGTTCATCTTCGCAAGGCGCCAGAAGGAA
 
. : . : . : . : . : . :
JMFS001A08+ CTAGCTTGGTCCTTGAACGCAAGCTTTTCATGGCGATAATTAGGATATGCAGCATCCAAG
JMFS153C12+ CTAGCTTGGTCCTTGAACGCAAGCTTTTCATGGCGATAATTAGGATATGCAGCATCCAAG
                      ____________________________________________________________
consensus CTAGCTTGGTCCTTGAACGCAAGCTTTTCATGGCGATAATTAGGATATGCAGCATCCAAG
 
. : . : . : . : . : . :
JMFS001A08+ GACAGGCTAAAGTCAGAGGTAGAGAAGTCAGATAGGCGACGAGAGTATGGAGATCGCCCA
JMFS153C12+ GACAGGCTAAAGTCAGAGGTAGAGAAGTCAGATAGGCGACGAGAGTATGGAGATCGCCCA
                      ____________________________________________________________
consensus GACAGGCTAAAGTCAGAGGTAGAGAAGTCAGATAGGCGACGAGAGTATGGAGATCGCCCA
 
. : . : . : . : . : . :
JMFS001A08+ TATGACGAGTTTCTTGCTATTATCGGTGAGCTCACAGAGTTCCTAGCACTAGAAGGCCTG
JMFS153C12+ TATGACGAGTTTCTTGCTATTATCGGTGAGCTCACAGAGTTCCTAGCACTAGAAGGCCTG
                      ____________________________________________________________
consensus TATGACGAGTTTCTTGCTATTATCGGTGAGCTCACAGAGTTCCTAGCACTAGAAGGCCTG
 
. : . : . : . : . : . :
JMFS001A08+ GCACTGCTCTTTCTTGCATTATTCATAGCTGTTTCGTGAGCTGCTTCCTGCATTCTAATA
JMFS153C12+ GCACTGCTCTTTCTTGCATTATTCATAGCTGTTTCGTGAGCTGCTTCCTGCATTCTAATA
                      ____________________________________________________________
consensus GCACTGCTCTTTCTTGCATTATTCATAGCTGTTTCGTGAGCTGCTTCCTGCATTCTAATA
 
. : . : . : . : . : . :
JMFS001A08+ AGTTTAGCATACACACCATGTTCTCCTTTAGAAATGAGCTCATCATGGGACCCGATTTCG
JMFS153C12+ AGTTTAGCATACACACCATGTTCTCCTTTAGAAATGAGCTCATCATGGGACCCGATTTCG
                      ____________________________________________________________
consensus AGTTTAGCATACACACCATGTTCTCCTTTAGAAATGAGCTCATCATGGGACCCGATTTCG
 
. : . : . : . : . : . :
JMFS001A08+ GAT--ACTGCCTTGCTGCAGAACGGCCACGAGGTCAGCCTTGCGGATGGTAGAAAGGCGA
JMFS153C12+ GATACACTGCCTTGCTGCAGAACGGCCACGAGGTCAGCCTTGCGGATGGTAGAAAGGCGA
                      ____________________________________________________________
consensus GATACACTGCCTTGCTGCAGAACGGCCACGAGGTCAGCCTTGCGGATGGTAGAAAGGCGA
 
. : . : . : . : . : . :
JMFS001A08+ TGGGCAATGACAAGAGTCGTCCTTCCAATCATGAACCTGTCGAGAGCCTCTTGCACTAGC
JMFS153C12+ TGGGCAATGACAAGAGTCGTCCTTCCAATCATGAACCTGTCGAGAGCCTCTTGCACTAGC
                      ____________________________________________________________
consensus TGGGCAATGACAAGAGTCGTCCTTCCAATCATGAACCTGTCGAGAGCCTCTTGCACTAGC
 
. : . : . : . : . : . :
JMFS001A08+ TTCTCCGATTCGGAATCTAATGCACTTGTCGCCTCATCCAACAGCAGGATTGCAGGGTTC
JMFS153C12+ TTCTCCGATTCGGAATCTAATGCACTTGTCGCCTCATCCAACAGCAGGATTGCAGGGTTC
                      ____________________________________________________________
consensus TTCTCCGATTCGGAATCTAATGCACTTGTCGCCTCATCCAACAGCAGGATTGCAGGGTTC
 
. : . : . : . : . : . :
JMFS001A08+ TTA
JMFS153C12+ TTAAGCATCGCCCTTGCAATAGCTATTCTTTGCTTCTGTCCACCAGATAATTGTAACCCC
                      ____________________________________________________________
consensus TTAAGCATCGCCCTTGCAATAGCTATTCTTTGCTTCTGTCCACCAGATAATTGTAACCCC