Previous Contig 004138:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF048L14Sequence484004138 (5)gb:LEU28007_16847269e-33Lycopersicon esculentum Pto kinase interactor 1 (Pti1) mRNA, complete cds.418010838 (3)gb:AF249317_17806966e-09Glycine max Pti1 kinase-like protein (Pti1a) mRNA, complete cds.
JMFS108H12Sequence617004138 (5)gb:LEU28007_16847262e-60Lycopersicon esculentum Pto kinase interactor 1 (Pti1) mRNA, complete cds.
JMFS135F12Sequence614004138 (5)gb:LEU28007_16847263e-74Lycopersicon esculentum Pto kinase interactor 1 (Pti1) mRNA, complete cds.
JMFS153C03Sequence615004138 (5)gb:LEU28007_16847262e-41Lycopersicon esculentum Pto kinase interactor 1 (Pti1) mRNA, complete cds.
JMSF023M05Sequence668004138 (5)gb:LEU28007_16847262e-65Lycopersicon esculentum Pto kinase interactor 1 (Pti1) mRNA, complete cds.790010838 (3)gb:AC087552_17341002e-83Oryza sativa (japonica cultivar-group) chromosome 5 clone P0519E07, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS135F12+ CGGGACCTGG
                      ____________________________________________________________
consensus CGGGACCTGG
 
. : . : . : . : . : . :
JMFS135F12+ CTGTGCACCTTTCACGCCTTTCTTTCCATGAAGAATATCATGAAGAGATCCATTTGGAGC
JMFS108H12+ GGAGC
JMSF023M05+ AATATCATGAAGAGATCCATTTGGAGC
                      ____________________________________________________________
consensus CTGTGCACCTTTCACGCCTTTCTTTCCATGAAGAATATCATGAAGAGATCCATTTGGAGC
 
. : . : . : . : . : . :
JMFS135F12+ GTACTCGTAGGCTAGTATGCGAAGGCCACCATCCACGCAATAACCAAGTAGCTCAATCAC
JMFS108H12+ GTACTCGTAGGCTAGTATGCGAAGGCCACCATCCACGCAATAACCAAGTAGCTCAATCAC
JMSF023M05+ GTACTCGTAGGCTAGTATGCGAAGGCCACCATCCACGCAATAACCAAGTAGCTCAATCAC
                      ____________________________________________________________
consensus GTACTCGTAGGCTAGTATGCGAAGGCCACCATCCACGCAATAACCAAGTAGCTCAATCAC
 
. : . : . : . : . : . :
JMFS135F12+ ATTTTCATGCTTTAGTCTCGACACCATAGAAACCTGTCCTAAAAACTCTCGATCGGGCTG
JMFS108H12+ ATTTTCATGCTTTAGTCTCGACACCATAGAAACCTGTCCTAAAAACTCTCGATCGGGCTG
JMSF023M05+ ATTTTCATGCTTTAGTCTCGACACCATAGAAACCTGTCCTAAAAACTCTCGATCGGGCTG
JMFS153C03+ CTCTCGATCGGGCTG
                      ____________________________________________________________
consensus ATTTTCATGCTTTAGTCTCGACACCATAGAAACCTGTCCTAAAAACTCTCGATCGGGCTG
 
. : . : . : . : . : . :
JMFS135F12+ CTTACTGGAGTCCAGCTTCTTTATGGCTGCAGCTCGCCCATTTTTAAGAATACCATAATA
JMFS108H12+ CTTACTGGAGTCCAGCTTCTTTATGGCTGCAGCTCGCCCATTTTTAAGAATACCATAATA
JMFF048L14+ TCGCCCATTTTTAAGAATACCATAATA
JMSF023M05+ CTTACTGGAGTCCAGCTTCTTTATGGCTGCAGCTCGCCCATTTTTAAGAATACCATAATA
JMFS153C03+ CTTACTGGAGTCCAGCTTCTTTATGGCTGCAGCTCGCCCATTTTTAAGAATACCATAATA
                      ____________________________________________________________
consensus CTTACTGGAGTCCAGCTTCTTTATGGCTGCAGCTCGCCCATTTTTAAGAATACCATAATA
 
. : . : . : . : . : . :
JMFS135F12+ CACCCTTCCGTATGACCCCTCGCCAATCAATGCCTTTGTGCCAAAATTGTCTGTGACATC
JMFS108H12+ CACCCTTCCGTATGACCCCTCGCCAATCAATGCCTTTGTGCCAAAATTGTCTGTGACATC
JMFF048L14+ CACCCTTCCGTATGACCCCTCGCCAATCAATGCCTTTGTGCCAAAATTGTCTGTGACATC
JMSF023M05+ CACCCTTCCGTATGACCCCTCGCCAATCAATGCCTTTGTGCCAAAATTGTCTGTGACATC
JMFS153C03+ CACCCTTCCGTATGACCCCTCGCCAATCAATGCCTTTGTGCCAAAATTGTCTGTGACATC
                      ____________________________________________________________
consensus CACCCTTCCGTATGACCCCTCGCCAATCAATGCCTTTGTGCCAAAATTGTCTGTGACATC
 
. : . : . : . : . : . :
JMFS135F12+ TTTTAACTCCTCAACTGGGAGGTCGGGGACAGTGATAGGCTGGATGTTCACAGGCTGTGT
JMFS108H12+ TTTTAACTCCTCAACTGGGAGGTCGGGGACAGTGATAGGCTGGATGTTCACAGGCTGTGT
JMFF048L14+ TTTTAACTCCTCAACTGGGAGGTCGGGGACAGTGATAGGCTGGATGTTCACAGGCTGTGT
JMSF023M05+ TTTTAACTCCTCAACTGGGAGGTCGGGGACAGTGATAGGCTGGATGTTCACAGGCTGTGT
JMFS153C03+ TTTTAACTCCTCAACTGGGAGGTCGGGGACAGTGATAGGCTGGATGTTCACAGGCTGTGT
                      ____________________________________________________________
consensus TTTTAACTCCTCAACTGGGAGGTCGGGGACAGTGATAGGCTGGATGTTCACAGGCTGTGT
 
. : . : . : . : . : . :
JMFS135F12+ TTCTTTTTGTGCACTTTCAGTGGCACGCTGACCAAAAGCACCTGCAGAACTATGTGGCAT
JMFS108H12+ TTCTTTTTGTGCACTTTCAGTGGCACGCTGACCAAAAGCACCTGCAGAACTATGTGGCAT
JMFF048L14+ TTCTTTTTGTGCACTTTCAGTGGCACGCTGACCAAAAGCACCTGCAGAACTATGTGGCAT
JMSF023M05+ TTCTTTTTGTGCACTTTCAGTGGCACGCTGACCAAAAGCACCTGCAGAACTATGTGGCAT
JMFS153C03+ TTCTTTTTGTGCACTTTCAGTGGCACGCTGACCAAAAGCACCTGCAGAACTATGTGGCAT
                      ____________________________________________________________
consensus TTCTTTTTGTGCACTTTCAGTGGCACGCTGACCAAAAGCACCTGCAGAACTATGTGGCAT
 
. : . : . : . : . : . :
JMFS135F12+ GTAAGGTCCATTATCAGGAGTCTTTCTCATGTCATCTTCATCAGAGCAACATCCAAAGCA
JMFS108H12+ GTAAGGTCCATTATCAGGAGTCTTTCTCATGTCATCTTCATCAGAGCAACATCCAAAGCA
JMFF048L14+ GTAAGGTCCATTATCAGGAGTCTTTCTCATGTCATCTTCATCAGAGCAACATCCAAAGCA
JMSF023M05+ GTAAGGTCCATTATCAGGAGTCTTTCTCATGTCATCTTCATCAGAGCAACATCCAAAGCA
JMFS153C03+ GTAAGGTCCATTATCAGGAGTCTTTCTCATGTCATCTTCATCAGAGCAACATCCAAAGCA
                      ____________________________________________________________
consensus GTAAGGTCCATTATCAGGAGTCTTTCTCATGTCATCTTCATCAGAGCAACATCCAAAGCA
 
. : . : . : . : . : . :
JMFS135F12+ ACTCATGGTTTGTATTCCCTCTCTTCTTTCCCACTTT-AAGAGATAGTTGTTGAGCTGTA
JMFS108H12+ ACTCATGGTTTGTATTCCCTCTCTTCTTTCCCACTTTCAAGAGATAGTTGTTGAGCTGTA
JMFF048L14+ ACTCATGGTTTGTATTCCCTCTCTTCTTTCCCACTTTCAAGAGATAGTTGTTGAGCTGTA
JMSF023M05+ ACTCATGGTTTGTATTCCCTCTCTTCTTTCCCACTTTAAAGAGATAGTTGTTGAGCTGTA
JMFS153C03+ ACTCATGGTTTGTATTCCCTCTCTTCTTTCCCACTTTCAAGAGATAGTTGTTGAGCTGTA
                      ____________________________________________________________
consensus ACTCATGGTTTGTATTCCCTCTCTTCTTTCCCACTTTCAAGAGATAGTTGTTGAGCTGTA
 
. : . : . : . : . : . :
JMFS135F12+ TCCAAAACCGTGGCCGCTTTATCCGATCAGCCGCCGGGAGAAAGGGTTGGGGGTAGGGGT
JMFS108H12+ TCCAAAACCGTGGCCGCTTTATCCGATCAGCCGCCGGGAGAAAGGGTTGGGGGTAGGGGT
JMFF048L14+ TCCAAAACCGTGGCCGCTTTATCCGATCAGCCGCCGGGAGAAAGGGTTGGGGGTAGGGGT
JMSF023M05+ TCCAAAACCGTGGCCGCTTTATCCGATCAGCCGCCGGGAGAAAGGGTTGGGGGTAGGGGT
JMFS153C03+ TCCAAAACCGTGGCCGCTTTATCCGATCAGCCGCCGGGAGAAAGGGTTGGGGGTAGGGGT
                      ____________________________________________________________
consensus TCCAAAACCGTGGCCGCTTTATCCGATCAGCCGCCGGGAGAAAGGGTTGGGGGTAGGGGT
 
. : . : . : . : . : . :
JMFS135F12+ TTTGG
JMFS108H12+ TTTGGGTATTGCACCGCTGATCTGAAATCAAGGTGTACTAAAAACCGC
JMFF048L14+ TTTGGGTATTGCACCGCTGATCTGAAATCAAGGTGTACTAAAAACCGC
JMSF023M05+ TTTGGGTATTGCACCGCTGATCTGAAATCAAGGTGTACTAAAAACCGC
JMFS153C03+ TTTGGGTATTGCACCGCTGATCTGAAATCAAGGTGTACTAAAAACCGCCTGAGAGGAAGC
                      ____________________________________________________________
consensus TTTGGGTATTGCACCGCTGATCTGAAATCAAGGTGTACTAAAAACCGCCTGAGAGGAAGC
 
. : . : . : . : . : . :
JMFS153C03+ GCGTACGTTAGCCCAGTCTTATCTTAGAGCTCAGAATTCTGACCAAATCAGACTGTGACC
                      ____________________________________________________________
consensus GCGTACGTTAGCCCAGTCTTATCTTAGAGCTCAGAATTCTGACCAAATCAGACTGTGACC
 
. : . : . : . : . : . :
JMFS153C03+ AGAGAAAAGAGAGAAGTTTGGGAGTAATTACTGGTAGTTTGGCTTAGTTGATCCGTCTCC
                      ____________________________________________________________
consensus AGAGAAAAGAGAGAAGTTTGGGAGTAATTACTGGTAGTTTGGCTTAGTTGATCCGTCTCC