Previous Contig 004137:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS153B12Sequence341004137 (2)
JMSF014C08Sequence486005455 (8)gb:AY051008_15624854e-33Arabidopsis thaliana putative HSP protein (At4g16660) mRNA, complete cds.781004137 (2)gb:AP003983_18359017e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014C08+ AAGAATGGTTATACACTGATGGTGAAGATGCATCAGCCACAGA
                      ____________________________________________________________
consensus AAGAATGGTTATACACTGATGGTGAAGATGCATCAGCCACAGA
 
. : . : . : . : . : . :
rJMSF014C08+ ATTTGAGAAAAAATTAGATATGTTGAAGGCTATTGGTGATCCTATATTCCATAGATATAA
                      ____________________________________________________________
consensus ATTTGAGAAAAAATTAGATATGTTGAAGGCTATTGGTGATCCTATATTCCATAGATATAA
 
. : . : . : . : . : . :
rJMSF014C08+ TGAGCTTACTGCACGCCCTGCTGCATCTGAACATGCTCGACGCTACCTCACTGAATTGCA
                      ____________________________________________________________
consensus TGAGCTTACTGCACGCCCTGCTGCATCTGAACATGCTCGACGCTACCTCACTGAATTGCA
 
. : . : . : . : . : . :
rJMSF014C08+ ACAGATTGTGCAAAGATGGGAAACAGATAAATCTTGGCTTCCTAGAGGGAGAATTGATGA
                      ____________________________________________________________
consensus ACAGATTGTGCAAAGATGGGAAACAGATAAATCTTGGCTTCCTAGAGGGAGAATTGATGA
 
. : . : . : . : . : . :
rJMSF014C08+ GGTTCTGGCTGAGGCTGAGAAACTGAAGAGTTGGCTGAATGAGAAGGAGGCTGAGCAGGC
                      ____________________________________________________________
consensus GGTTCTGGCTGAGGCTGAGAAACTGAAGAGTTGGCTGAATGAGAAGGAGGCTGAGCAGGC
 
. : . : . : . : . : . :
rJMSF014C08+ TAAGACTCCAGGATATAGCAAACCAGTATTCACATCAGAAGAAGTATACAACAAGTTATT
                      ____________________________________________________________
consensus TAAGACTCCAGGATATAGCAAACCAGTATTCACATCAGAAGAAGTATACAACAAGTTATT
 
. : . : . : . : . : . :
rJMSF014C08+ TGATCTTCAAGATAAGGTGGCCAAGGTCAATAAAATTCCTAAACCAAAGCCAAAGGTCGA
                      ____________________________________________________________
consensus TGATCTTCAAGATAAGGTGGCCAAGGTCAATAAAATTCCTAAACCAAAGCCAAAGGTCGA
 
. : . : . : . : . : . :
rJMSF014C08+ GAAGCCCGCAAAGAATGAAACCGAGAACAATGGACAAAAAGAAAAGGCTGACTCGTCTTC
                      ____________________________________________________________
consensus GAAGCCCGCAAAGAATGAAACCGAGAACAATGGACAAAAAGAAAAGGCTGACTCGTCTTC
 
. : . : . : . : . : . :
rJMSF014C08+ TGAGGAACCCTCAAAGAAAGAGCAAACTGGAGATTCGGAGAAACCAGCCAGTGGTGAAAA
JMFS153B12+ GAGCAAACTGGAGATTCGGAGAAACCAGCCAGTGGTGAAAA
                      ____________________________________________________________
consensus TGAGGAACCCTCAAAGAAAGAGCAAACTGGAGATTCGGAGAAACCAGCCAGTGGTGAAAA
 
. : . : . : . : . : . :
rJMSF014C08+ ACCTAGTGCCAAATCCAACGGTGATGGCCAGACAGAAAGGCACGATGAGTTATGATTTTT
JMFS153B12+ ACCTAGTGCCAAATCCAACGGTGATGGCCAGACAGAAAGGCACGATGAGTTATGATTTTT
                      ____________________________________________________________
consensus ACCTAGTGCCAAATCCAACGGTGATGGCCAGACAGAAAGGCACGATGAGTTATGATTTTT
 
. : . : . : . : . : . :
rJMSF014C08+ TTAGAACAAATTCACGTAGGCATATAGAGGTTAGAAAGAGACAAGAACAGCAACTTCAAT
JMFS153B12+ TTAGAACAAATTCACGTAGGCATATAGAGGTTAGAAAGAGACAAGAACAGCAACTTCAAT
                      ____________________________________________________________
consensus TTAGAACAAATTCACGTAGGCATATAGAGGTTAGAAAGAGACAAGAACAGCAACTTCAAT
 
. : . : . : . : . : . :
rJMSF014C08+ GGAGGAGTGAAGTGAAGCCCCATGTTTCTTGATCCCACTCTCCCTTTGTTAAACTTTGAA
JMFS153B12+ GGAGGAGTGAAGTGAAGCCCCATGTTTCTTGATCCCACTCTCCCTTTGTTAAACTTTGAA
                      ____________________________________________________________
consensus GGAGGAGTGAAGTGAAGCCCCATGTTTCTTGATCCCACTCTCCCTTTGTTAAACTTTGAA
 
. : . : . : . : . : . :
rJMSF014C08+ TAGTCAATGCCAAGAGGATCATATGCTTCATTTGAGTTATTTGTAGCAAAACACTCCTGT
JMFS153B12+ TAGTCAATGCCAAGAGGATCATATGCTTCATTTGAGTTATTTGTAGCAAAACACTCCTGT
                      ____________________________________________________________
consensus TAGTCAATGCCAAGAGGATCATATGCTTCATTTGAGTTATTTGTAGCAAAACACTCCTGT
 
. : . : . : . : . : . :
rJMSF014C08+ ATAAACTCCAAGATAACA
JMFS153B12+ ATAAACTCCAAGATAACATGCAGCATTTGAACTGCAAAAAGAATTTTGTTAGCTTTGTCC
                      ____________________________________________________________
consensus ATAAACTCCAAGATAACATGCAGCATTTGAACTGCAAAAAGAATTTTGTTAGCTTTGTCC