Previous Contig 004126:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS030G02Sequence622004126 (2)pir|D96563|D965631e-12probable bZIP protein, 48652-45869 [imported] - Arabidopsis thaliana>gb:AE005173
JMFS151D12Sequence618004126 (2)pir|D96563|D965631e-12probable bZIP protein, 48652-45869 [imported] - Arabidopsis thaliana>gb:AE005173

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS030G02+ CTCCTCCTCCTCCTCCTCCTCATCAATCGCGATGCTCTTC
JMFS151D12+ TCAATCGCGATGCTCTTC
                      ____________________________________________________________
consensus CTCCTCCTCCTCCTCCTCCTCATCAATCGCGATGCTCTTC
 
. : . : . : . : . : . :
JMFS030G02+ ATCTTCCCCCTCGATTTAGAGAACTCAGGCATCGTCATGGCCCGCTGCAGCGGCGGCATA
JMFS151D12+ ATCTTCCCCCTCGATTTAGAGAACTCAGGCATCGTCATGGCCCGCTGCAGCGGCGGCATA
                      ____________________________________________________________
consensus ATCTTCCCCCTCGATTTAGAGAACTCAGGCATCGTCATGGCCCGCTGCAGCGGCGGCATA
 
. : . : . : . : . : . :
JMFS030G02+ GGAGAGAAGCTCGGCAACGGCGGCGGCAGAGGAGAGAAGCTCGGCAACGGCGGGGGCGGC
JMFS151D12+ GGAGAGAAGCTCGGCAACGGCGGCGGCAGAGGAGAGAAGCTCGGCAACGGCGGGGGCGGC
                      ____________________________________________________________
consensus GGAGAGAAGCTCGGCAACGGCGGCGGCAGAGGAGAGAAGCTCGGCAACGGCGGGGGCGGC
 
. : . : . : . : . : . :
JMFS030G02+ GGAGGGAGGGGAGTCCTCTCCATCATATGCGGCGGAGGCGGCGGCGGCGGCTCAGATGCC
JMFS151D12+ GGAGGGAGGGGAGTCCTCTCCATCATATGCGGCGGAGGCGGCGGCGGCGGCTCAGATGCC
                      ____________________________________________________________
consensus GGAGGGAGGGGAGTCCTCTCCATCATATGCGGCGGAGGCGGCGGCGGCGGCTCAGATGCC
 
. : . : . : . : . : . :
JMFS030G02+ GGCTCGCTCACAACCACCGGCGACTGAGGCGGAGGCGGCGCCTCTCCTTGCGCGTAGTCG
JMFS151D12+ GGCTCGCTCACAACCACCGGCGACTGAGGCGGAGGCGGCGCCTCTCCTTGCGCGTAGTCG
                      ____________________________________________________________
consensus GGCTCGCTCACAACCACCGGCGACTGAGGCGGAGGCGGCGCCTCTCCTTGCGCGTAGTCG
 
. : . : . : . : . : . :
JMFS030G02+ TTCAAGGCGGCGCCGGTGTTCTTCAGAGCCATAGCGTATGCGGAGTGAGCCGAAGCAAAG
JMFS151D12+ TTCAAGGCGGCGCCGGTGTTCTTCAGAGCCATAGCGTATGCGGAGTGAGCCGAAGCAAAG
                      ____________________________________________________________
consensus TTCAAGGCGGCGCCGGTGTTCTTCAGAGCCATAGCGTATGCGGAGTGAGCCGAAGCAAAG
 
. : . : . : . : . : . :
JMFS030G02+ GCGTTCCTCACCATTACCGCTTGTTTCATCAGATTCCTCCGGTCCTTGCATCTCGACACC
JMFS151D12+ GCGTTCCTCACCATTACCGCTTGTTTCATCAGATTCCTCCGGTCCTTGCATCTCGACACC
                      ____________________________________________________________
consensus GCGTTCCTCACCATTACCGCTTGTTTCATCAGATTCCTCCGGTCCTTGCATCTCGACACC
 
. : . : . : . : . : . :
JMFS030G02+ GATTCTTCGTTGTCCAATCTCGATTGAGCACACCCCATTGCTCCTTAATTCTTACCTTAG
JMFS151D12+ GATTCTTCGTTGTCCAATCTCGATTGAGCACACCCCATTGCTCCTTAATTCTTACCTTAG
                      ____________________________________________________________
consensus GATTCTTCGTTGTCCAATCTCGATTGAGCACACCCCATTGCTCCTTAATTCTTACCTTAG
 
. : . : . : . : . : . :
JMFS030G02+ GGCAAAATCTTAACCTCGATCTTCTAGATCATACATATACATATACATATATATATTCTC
JMFS151D12+ GGCAAAATCTTAACCTCGATCTTCTAGATCATACATATACATATACATATATATATTCTC
                      ____________________________________________________________
consensus GGCAAAATCTTAACCTCGATCTTCTAGATCATACATATACATATACATATATATATTCTC
 
. : . : . : . : . : . :
JMFS030G02+ CAGATTACATGCACAAATTAAACACAATTTAAGAAATAAAGCTATTCAGTATTCACAATG
JMFS151D12+ CAGATTACATGCACAAATTAAACACAATTTAAGAAATAAAGCTATTCAGTATTCACAATG
                      ____________________________________________________________
consensus CAGATTACATGCACAAATTAAACACAATTTAAGAAATAAAGCTATTCAGTATTCACAATG
 
. : . : . : . : . : . :
JMFS030G02+ CTGATGCAAATACATACAGTGATATAGAGAGAGAGAGAAAAG
JMFS151D12+ CTGATGCAAATACATACAGTGATATAGAGAGAGAGAGAAAAGGGTTTGGGCGGCGTAAGG
                      ____________________________________________________________
consensus CTGATGCAAATACATACAGTGATATAGAGAGAGAGAGAAAAGGGTTTGGGCGGCGTAAGG