Previous Contig 004125:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS151C02Sequence520004125 (2)gb:AY091025_15742554e-32Arabidopsis thaliana unknown protein (At2g20190) mRNA, complete cds.
JMSF006K01Sequence424004125 (2)gb:AY091025_15742554e-23Arabidopsis thaliana unknown protein (At2g20190) mRNA, complete cds.387011345 (2)gb:OSJN00169_16961025e-11Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0043L24, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF006K01+ CTTC
JMFS151C02+ TCAAGAAACCCCCTTTCCTGTAGCTTTTCAGAAGCTCTTC
                      ____________________________________________________________
consensus TCAAGAAACCCCCTTTCCTGTAGCTTTTCAGAAGCTCTTC
 
. : . : . : . : . : . :
JMSF006K01+ TTGTCAAGTGGGATGAAACTGTTGATATTGGTTCATTTCCAACATTACTAAGGTATGAGA
JMFS151C02+ TTGTCAAGTGGGATGAAACTGTTGATATTGGTTCATTTCCAACATTACTAAGGTATGAGA
                      ____________________________________________________________
consensus TTGTCAAGTGGGATGAAACTGTTGATATTGGTTCATTTCCAACATTACTAAGGTATGAGA
 
. : . : . : . : . : . :
JMSF006K01+ ATTTAGCAGAATTTTTTGAAACCTGGATCTGTGAGAAGATGTCAGACAAACCCAACCCAC
JMFS151C02+ ATTTAGCAGAATTTTTTGAAACCTGGATCTGTGAGAAGATGTCAGACAAACCCAACCCAC
                      ____________________________________________________________
consensus ATTTAGCAGAATTTTTTGAAACCTGGATCTGTGAGAAGATGTCAGACAAACCCAACCCAC
 
. : . : . : . : . : . :
JMSF006K01+ CATTGCGATTATTGCCTTTCGAGATACCAGATGGTGTATCTATTAATAAGGCATTTGCAA
JMFS151C02+ CATTGCGATTATTGCCTTTCGAGATACCAGATGGTGTATCTATTAATAAGGCATTTGCAA
                      ____________________________________________________________
consensus CATTGCGATTATTGCCTTTCGAGATACCAGATGGTGTATCTATTAATAAGGCATTTGCAA
 
. : . : . : . : . : . :
JMSF006K01+ GACTACTTGATGCGGGAACTGCAGGGGGGAAAGGTGGATCACGAGAAGATGGTGGGTCAA
JMFS151C02+ GACTACTTGATGCGGGAACTGCAGGGGGGAAAGGTGGATCACGAGAAGATGGTGGGTCAA
                      ____________________________________________________________
consensus GACTACTTGATGCGGGAACTGCAGGGGGGAAAGGTGGATCACGAGAAGATGGTGGGTCAA
 
. : . : . : . : . : . :
JMSF006K01+ CTCCTAGATCCAGACTTGATGAACGGATTTTCCCAGATGCATCCCGGCCTTTAAGCAAGC
JMFS151C02+ CTCCTAGATCCAGACTTGATGAACGGATTTTCCCAGATGCATCCCGGCCTTTAAGCAAGC
                      ____________________________________________________________
consensus CTCCTAGATCCAGACTTGATGAACGGATTTTCCCAGATGCATCCCGGCCTTTAAGCAAGC
 
. : . : . : . : . : . :
JMSF006K01+ TTTCTATAGCAGAAACTTTCTGTTTGCTGGCATGCAGTACACTTTCCAAGCTACGTGTTG
JMFS151C02+ TTTCTATAGCAGAAACTTTCTGTTTGCTGGCATGCAGTACACTTTCCAAGCTACGTGTTG
                      ____________________________________________________________
consensus TTTCTATAGCAGAAACTTTCTGTTTGCTGGCATGCAGTACACTTTCCAAGCTACGTGTTG
 
. : . : . : . : . : . :
JMSF006K01+ TGCCTGTAGCCACAGGTTTCATCTGTGACAGGAGTAATCCAGAGGAGAGAGGTGTCGCAG
JMFS151C02+ TGCCTGTAGCCACAGGTTTCATCTGTGACAGGAGTAATCCAGAGGAGAGAGGTGTCGCAG
                      ____________________________________________________________
consensus TGCCTGTAGCCACAGGTTTCATCTGTGACAGGAGTAATCCAGAGGAGAGAGGTGTCGCAG
 
. : . : . : . : . : . :
JMFS151C02+ TGGGCAAACTCGCACTTCTATCCATTGCAACTATCGCAGAGGTCCCAGAACCAGGACGGT
                      ____________________________________________________________
consensus TGGGCAAACTCGCACTTCTATCCATTGCAACTATCGCAGAGGTCCCAGAACCAGGACGGT