Previous Contig 004124:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS151B10Sequence614004124 (3)gb:BT015413_16422416e-43Arabidopsis thaliana At3g46980 gene, complete cds.
JMSF029P09Sequence698004124 (3)gb:BT015413_16422412e-95Arabidopsis thaliana At3g46980 gene, complete cds.721004124 (3)gb:AP003279_18271125e-83Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P052

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF029P09- GGA
                      ____________________________________________________________
consensus GGA
 
. : . : . : . : . : . :
rJMSF029P09- TTCACAAATTTACACAGTTTGATGTCAACATTTCATGGAAAAAGTTGATATTTACCAGCA
                      ____________________________________________________________
consensus TTCACAAATTTACACAGTTTGATGTCAACATTTCATGGAAAAAGTTGATATTTACCAGCA
 
. : . : . : . : . : . :
rJMSF029P09- CAGCTTTCCCATGGTGAAAAATGCTCCTAATGTCTACAGCCCCATTTTACTCTACGACTG
                      ____________________________________________________________
consensus CAGCTTTCCCATGGTGAAAAATGCTCCTAATGTCTACAGCCCCATTTTACTCTACGACTG
 
. : . : . : . : . : . :
rJMSF029P09- AAGTATTTGACAACCTTTGAGGGGGACCTAAGTAGTTTCATCGAAGCTAACCCTCTCTCC
                      ____________________________________________________________
consensus AAGTATTTGACAACCTTTGAGGGGGACCTAAGTAGTTTCATCGAAGCTAACCCTCTCTCC
 
. : . : . : . : . : . :
rJMSF029P09- TGTAGAAAAGATGTTATAGAAGAGAGCAGCACAGAAATACAGAAATGCTGTAAGCAACAA
                      ____________________________________________________________
consensus TGTAGAAAAGATGTTATAGAAGAGAGCAGCACAGAAATACAGAAATGCTGTAAGCAACAA
 
. : . : . : . : . : . :
rJMSF029P09- AAATCCCTGGAAGGAACCAACTAAGTCGACGAAGAAGCCAGCACCAACAGTTCCAATGAT
                      ____________________________________________________________
consensus AAATCCCTGGAAGGAACCAACTAAGTCGACGAAGAAGCCAGCACCAACAGTTCCAATGAT
 
. : . : . : . : . : . :
rJMSF029P09- GGCTGCAAGTGTACCCGCAGTGTTTGAAATGCCATGCAGAACACCTGAATACTGTGGGGC
                      ____________________________________________________________
consensus GGCTGCAAGTGTACCCGCAGTGTTTGAAATGCCATGCAGAACACCTGAATACTGTGGGGC
 
. : . : . : . : . : . :
rJMSF029P09- AATTTCCTGAAGGTTTACAAGGAAGCCAGCGTGACTGAATGCTTTCAACCCAACAGCTAA
                      ____________________________________________________________
consensus AATTTCCTGAAGGTTTACAAGGAAGCCAGCGTGACTGAATGCTTTCAACCCAACAGCTAA
 
. : . : . : . : . : . :
rJMSF029P09- AGTAAGCCAAGCTGATGCTATCAATGGAGTTCGAGCCATAGTTAAACCAATGAGAGCAAT
                      ____________________________________________________________
consensus AGTAAGCCAAGCTGATGCTATCAATGGAGTTCGAGCCATAGTTAAACCAATGAGAGCAAT
 
. : . : . : . : . : . :
rJMSF029P09- CCCAGGTCCAAAGAAACCAATTGATTGCATGACTTTGCGGGTTAGTGTAACACTTGTACC
                      ____________________________________________________________
consensus CCCAGGTCCAAAGAAACCAATTGATTGCATGACTTTGCGGGTTAGTGTAACACTTGTACC
 
. : . : . : . : . : . :
rJMSF029P09- GCTTTCGATCATCCGGTCAGACAAAACACCAGCAACGTAGCCCATTAATGCCATCATACT
JMSF029P09+ AAAACACCAGCAACGTAGCCCATTAATGCCATCATACT
                      ____________________________________________________________
consensus GCTTTCGATCATCCGGTCAGACAAAACACCAGCAACGTAGCCCATTAATGCCATCATACT
 
. : . : . : . : . : . :
rJMSF029P09- CCATGGAACAGCACTAAACCATGCTGCATGTCTGAGATCAACACGGTATATAGTCTTGAA
JMSF029P09+ CCATGGAACAGCACTAAACCATGCTGCATGTCTGAGATCAACACGGTATATAGTCTTGAA
                      ____________________________________________________________
consensus CCATGGAACAGCACTAAACCATGCTGCATGTCTGAGATCAACACGGTATATAGTCTTGAA
 
. : . : . : . : . : . :
rJMSF029P09- GTAAATTGGCATCCATGATAGTATTACAAAGAAGCCCCAACTATGCATGGAATTTGCC
JMSF029P09+ GTAAATTGGCATCCATGATAGTATTACAAAGAAGCCCCAACTATGCATGGAATTTGCCAC
                      ____________________________________________________________
consensus GTAAATTGGCATCCATGATAGTATTACAAAGAAGCCCCAACTATGCATGGAATTTGCCAC
 
. : . : . : . : . : . :
JMSF029P09+ AATTAGAGACCATGTTGGTAGCTTAGAGAGCAAGCGTCTGAAAGGTGGGATCACTTTGGC
                      ____________________________________________________________
consensus AATTAGAGACCATGTTGGTAGCTTAGAGAGCAAGCGTCTGAAAGGTGGGATCACTTTGGC
 
. : . : . : . : . : . :
JMSF029P09+ TGTTTTCATTTTACTGTCAACAGCAGAATGGCTAAGTCCCTTGTTTTGTATGTAACGCAG
                      ____________________________________________________________
consensus TGTTTTCATTTTACTGTCAACAGCAGAATGGCTAAGTCCCTTGTTTTGTATGTAACGCAG
 
. : . : . : . : . : . :
JMSF029P09+ TTCATTTAATGATATTTGACGGCTCCGCTCAGGAGTACTGGAGGTTGCAGACACCCACAC
                      ____________________________________________________________
consensus TTCATTTAATGATATTTGACGGCTCCGCTCAGGAGTACTGGAGGTTGCAGACACCCACAC
 
. : . : . : . : . : . :
JMSF029P09+ TAGAACCCAAAGAAACCCAGATAAACCAAATATGACAAATGGTCCAAATAAACCACCCTG
                      ____________________________________________________________
consensus TAGAACCCAAAGAAACCCAGATAAACCAAATATGACAAATGGTCCAAATAAACCACCCTG
 
. : . : . : . : . : . :
JMSF029P09+ TGACATAAGAATTGGAGAAAGTGTGAGCCCAATAGCACTTCCAAGCTGAAATCCAGCCAT
                      ____________________________________________________________
consensus TGACATAAGAATTGGAGAAAGTGTGAGCCCAATAGCACTTCCAAGCTGAAATCCAGCCAT
 
. : . : . : . : . : . :
JMSF029P09+ TGCCATCCCTACAGCCCTTGATCGTTCTGTCTGAGGAAACCATCTGACGATCATATTGTT
                      ____________________________________________________________
consensus TGCCATCCCTACAGCCCTTGATCGTTCTGTCTGAGGAAACCATCTGACGATCATATTGTT
 
. : . : . : . : . : . :
JMSF029P09+ CATGCAGGGAAGAGCTACACCTTCTGCTATGCCAAGCAACATCCGCGTGGAAAGCAGTGC
JMFS151B10+ GTGGAAAGCAGTGC
                      ____________________________________________________________
consensus CATGCAGGGAAGAGCTACACCTTCTGCTATGCCAAGCAACATCCGCGTGGAAAGCAGTGC
 
. : . : . : . : . : . :
JMSF029P09+ CCACAAGGAAACCTCCACTGCCCAAGGGGTTAGAAAAGTTGCTAAAGACCAGAGAATCAC
JMFS151B10+ CCACAAGGAAACCTCCACTGCCCAAGGGGTTAGAAAAGTTGCTAAAGACCAGAGAATCAC
                      ____________________________________________________________
consensus CCACAAGGAAACCTCCACTGCCCAAGGGGTTAGAAAAGTTGCTAAAGACCAGAGAATCAC
 
. : . : . : . : . : . :
JMSF029P09+ ACCCCATGTCATGACTACCTTGC
JMFS151B10+ ACCCCATGTCATGACTACCTTGCCACCAAAATAATCCACCAGAGTCCCTCCAGCTATTGG
                      ____________________________________________________________
consensus ACCCCATGTCATGACTACCTTGCCACCAAAATAATCCACCAGAGTCCCTCCAGCTATTGG
 
. : . : . : . : . : . :
JMFS151B10+ CGATATCAGGTAACCCCAGAGAAAAGATGACTGAACAACGCCAGCGAACGATTGACGCCA
                      ____________________________________________________________
consensus CGATATCAGGTAACCCCAGAGAAAAGATGACTGAACAACGCCAGCGAACGATTGACGCCA
 
. : . : . : . : . : . :
JMFS151B10+ GCCATGAGAGGCCGATAAAGGAACGATCGCCACCGACATTACGACACGGTCGGCGTTACA
                      ____________________________________________________________
consensus GCCATGAGAGGCCGATAAAGGAACGATCGCCACCGACATTACGACACGGTCGGCGTTACA
 
. : . : . : . : . : . :
JMFS151B10+ TAAAGCCAAAGCCAAGGCTAACATAGCCACCACTTTCACTCTCTCCGAAGTAATGAACTC
                      ____________________________________________________________
consensus TAAAGCCAAAGCCAAGGCTAACATAGCCACCACTTTCACTCTCTCCGAAGTAATGAACTC
 
. : . : . : . : . : . :
JMFS151B10+ TGCGAAGCTGGGCTCTCGCACTCCCCCTCTGTCTCTGAACGAACCGCCAGCAACCGACCG
                      ____________________________________________________________
consensus TGCGAAGCTGGGCTCTCGCACTCCCCCTCTGTCTCTGAACGAACCGCCAGCAACCGACCG
 
. : . : . : . : . : . :
JMFS151B10+ AGCATCGTTCGACGAAGCTTTAATTGCGGTCAATCGGAGATTCCGAGTCGAGAATTCGCG
                      ____________________________________________________________
consensus AGCATCGTTCGACGAAGCTTTAATTGCGGTCAATCGGAGATTCCGAGTCGAGAATTCGCG
 
. : . : . : . : . : . :
JMFS151B10+ TCTAAGAATACTGTTTACAGTCAAGAACTCAGAGCAGCTCCGGTTGGATAAGCGCGACGG
                      ____________________________________________________________
consensus TCTAAGAATACTGTTTACAGTCAAGAACTCAGAGCAGCTCCGGTTGGATAAGCGCGACGG
 
. : . : . : . : . : . :
JMFS151B10+ TAGCGTTACGTTTGATAACAGCCGCCGCTTTGAGGGTTTAAGGCTTTGGAGGGCGGGAAT
                      ____________________________________________________________
consensus TAGCGTTACGTTTGATAACAGCCGCCGCTTTGAGGGTTTAAGGCTTTGGAGGGCGGGAAT
 
. : . : . : . : . : . :
JMFS151B10+ TGTGACTGTACGGCGGAGACTGGCCGGAGAATTCATGTTCGAAGCGCTAGTATAACAGTA
                      ____________________________________________________________
consensus TGTGACTGTACGGCGGAGACTGGCCGGAGAATTCATGTTCGAAGCGCTAGTATAACAGTA