Previous Contig 004123:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039C14Sequence472004123 (28)gb:AY250115_15927242e-58Lycopersicon pennellii aconitase mRNA, partial cds.699010024 (6)gb:AF194945_17758056e-61Nicotiana tabacum cytosolic aconitase (ACO) mRNA, complete cds.
JMFS006A01Sequence529004123 (28)gb:AY250115_15927241e-93Lycopersicon pennellii aconitase mRNA, partial cds.
JMFS012E01Sequence608004123 (28)gb:AY136414_15819156e-75Arabidopsis thaliana cytoplasmic aconitate hydratase (At2g05710) mRNA, complete
JMFS019E03Sequence596004123 (28)gb:AY050431_15622086e-19Arabidopsis thaliana AT4g26970/F10M23_310 mRNA, complete cds.>gb:BT000492_163477
JMFS023D02Sequence405004123 (28)gb:AY250115_15927241e-58Lycopersicon pennellii aconitase mRNA, partial cds.
JMFS036F04Sequence619004123 (28)gb:AY136414_15819151e-60Arabidopsis thaliana cytoplasmic aconitate hydratase (At2g05710) mRNA, complete
JMFS038A04Sequence638004123 (28)gb:AY136414_15819154e-74Arabidopsis thaliana cytoplasmic aconitate hydratase (At2g05710) mRNA, complete
JMFS047C12Sequence607004123 (28)gb:AY250115_1592724e-107Lycopersicon pennellii aconitase mRNA, partial cds.
JMFS054D07Sequence624004123 (28)gb:AY050431_15622087e-31Arabidopsis thaliana AT4g26970/F10M23_310 mRNA, complete cds.>gb:BT000492_163477
JMFS056F06Sequence627004123 (28)gb:AY136414_15819151e-49Arabidopsis thaliana cytoplasmic aconitate hydratase (At2g05710) mRNA, complete
JMFS066E04Sequence627004123 (28)gb:AY250115_15927241e-88Lycopersicon pennellii aconitase mRNA, partial cds.
JMFS075B04Sequence627004123 (28)gb:AY136414_15819155e-65Arabidopsis thaliana cytoplasmic aconitate hydratase (At2g05710) mRNA, complete
JMFS089B03Sequence658004123 (28)gb:AF194945_17758057e-96Nicotiana tabacum cytosolic aconitase (ACO) mRNA, complete cds.
JMFS092E01Sequence627004123 (28)gb:AY136414_15819152e-73Arabidopsis thaliana cytoplasmic aconitate hydratase (At2g05710) mRNA, complete
JMFS107A09Sequence627004123 (28)gb:AY136414_15819152e-72Arabidopsis thaliana cytoplasmic aconitate hydratase (At2g05710) mRNA, complete
JMFS108F09Sequence622004123 (28)gb:AY136414_15819151e-67Arabidopsis thaliana cytoplasmic aconitate hydratase (At2g05710) mRNA, complete
JMFS111A07Sequence619004123 (28)gb:AY250115_1592724e-107Lycopersicon pennellii aconitase mRNA, partial cds.
JMFS114E02Sequence528004123 (28)gb:AY136414_15819154e-52Arabidopsis thaliana cytoplasmic aconitate hydratase (At2g05710) mRNA, complete
JMFS114E03Sequence531004123 (28)gb:AY136414_15819156e-53Arabidopsis thaliana cytoplasmic aconitate hydratase (At2g05710) mRNA, complete
JMFS115F10Sequence626004123 (28)gb:AY050431_15622081e-33Arabidopsis thaliana AT4g26970/F10M23_310 mRNA, complete cds.>gb:BT000492_163477
JMFS116B03Sequence133004123 (28)
JMFS120F06Sequence627004123 (28)sp|P49608|ACOC_CUCMA3e-99Aconitate hydratase, cytoplasmic (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase).
JMFS122B08Sequence574004123 (28)gb:AY136414_15819152e-59Arabidopsis thaliana cytoplasmic aconitate hydratase (At2g05710) mRNA, complete
JMFS142F01Sequence618004123 (28)gb:AY250115_1592724e-105Lycopersicon pennellii aconitase mRNA, partial cds.
JMFS145C05Sequence626004123 (28)gb:AY136414_15819155e-75Arabidopsis thaliana cytoplasmic aconitate hydratase (At2g05710) mRNA, complete
JMFS150G09Sequence590004123 (28)
JMFS159B05Sequence514004123 (28)gb:AY136414_15819156e-49Arabidopsis thaliana cytoplasmic aconitate hydratase (At2g05710) mRNA, complete
JMFS165H08Sequence612004123 (28)gb:AY250115_15927247e-94Lycopersicon pennellii aconitase mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS120F06+ TAACATGATCTACAGGGAAGAATCCCATAGTTGCACCATATTCAGGAGACA
                      ____________________________________________________________
consensus TAACATGATCTACAGGGAAGAATCCCATAGTTGCACCATATTCAGGAGACA
 
. : . : . : . : . : . :
JMFS120F06+ TGTTAGCAATGGTTGCTCTGTCAGCTAATGATAGTTCACCCACACCATCACCATGGAATT
JMFS089B03+ TAGTTCACCCACACCATCACCATGGAATT
                      ____________________________________________________________
consensus TGTTAGCAATGGTTGCTCTGTCAGCTAATGATAGTTCACCCACACCATCACCATGGAATT
 
. : . : . : . : . : . :
JMFS120F06+ CAACGAACTTTCCGACAACACCATGCTTCCTCAGCATTTGTGTCACAGTTAAAACTAAAT
JMFS089B03+ CAACGAACTTTCCGACAACACCATGCTTCCTCAGCATNTGTGTCACAGTTAAAACTAAAT
                      ____________________________________________________________
consensus CAACGAACTTTCCGACAACACCATGCTTCCTCAGCATTTGTGTCACAGTTAAAACTAAAT
 
. : . : . : . : . : . :
JMFS120F06+ CTGTCGCTGTGACACCATTGCGCAATTTCCCTGCTAACTTGAACCCAACAACTCCAGGCA
JMFS089B03+ CTGTCGCTGTGACACCATTGCGCAATTTCCCTGCTAACTTGAACCCAACAACTCCAGGCA
                      ____________________________________________________________
consensus CTGTCGCTGTGACACCATTGCGCAATTTCCCTGCTAACTTGAACCCAACAACTCCAGGCA
 
. : . : . : . : . : . :
JMFS120F06+ ACACCATACTCATTGGCTGACCAAGCATTGCTGCTTCCGCTTCGATACCTCCAACACCCC
JMFS089B03+ ACACCATACTCATTGGCTGACCAAGCATTGCTGCTTCCGCTTCGATACCTCCAACACCCC
                      ____________________________________________________________
consensus ACACCATACTCATTGGCTGACCAAGCATTGCTGCTTCCGCTTCGATACCTCCAACACCCC
 
. : . : . : . : . : . :
JMFS120F06+ AGCCAGCAACTCCTAGGCCATCAATCATAGTGGTATGGGAATCTGTTCCAACCACACTAT
JMFS089B03+ AGCCAGCAACTCCTAGGCCATCAATCATAGTGGTATGGGAATCTGTTCCAACCACACTAT
JMFS142F01+ TCCAACCACACTAT
                      ____________________________________________________________
consensus AGCCAGCAACTCCTAGGCCATCAATCATAGTGGTATGGGAATCTGTTCCAACCACACTAT
 
. : . : . : . : . : . :
JMFS120F06+ CTGGATAAAGTATGCCATCAGTGTTGAACACAACCCGTCCAAGATACTCAAGGTTCACCT
JMFS089B03+ CTGGATAAAGTATGCCATCAGTGTTGAACACAACCCGTCCAAGATACTCAAGGTTCACCT
JMFS142F01+ CTGGATAAAGTATGCCATCAGTG-TGAACACAACCCGTCCAAGATACTCAAGGTTCACCT
JMFS006A01+ GTATGCCATCAGTGTTGAACACAACCCGTCCAAGATACTCAAGGTTCACCT
JMFS047C12+ GATAAAGTATGCCATCAGTGTTGAACACAACCCGTCCAAGATACTCAAGGTTCACCT
JMFS111A07+ GATAAAGTATGCCATCAGTGTTGAACACAACCCGTCCAAGATACTCAAGGTTCACCT
                      ____________________________________________________________
consensus CTGGATAAAGTATGCCATCAGTGTTGAACACAACCCGTCCAAGATACTCAAGGTTCACCT
 
. : . : . : . : . : . :
JMFS120F06+ GATGGACAATTCCAGAACCAGGTGGGACAACAAGCATGTTGCGGAAAGCATTAGATCCCC
JMFS089B03+ GATGGACAATTCCAGAACCAGGTGGGACAACAAGCATGTTGCGGAAAGCATTAGATCCCC
JMFS142F01+ GATGGACAATTCCAGAACCAGGTGGGACAACAAGCATGTTGCGGAAAGCATTAGATCCCC
JMFS006A01+ GATGGACAATTCCAGAACCAGGTGGGACAACAAGCATGTTGCGGAAAGCATTAGATCCCC
JMFS047C12+ GATGGACAATTCCAGAACCAGGTGGGACAACAAGCATGTTGCGGAAAGCATTAGATCCCC
JMFS165H08+ AACCAGGTGGGACANCAAGCATGTTGCGGAAAGCATTAGATCCCC
JMFS066E04+ TGCGGAAAGCATTAGATCCCC
JMFS111A07+ GATGGACAATTCCAGAACCAGGTGGGACAACAAGCATGTTGCGGAAAGCATTAGATCCCC
                      ____________________________________________________________
consensus GATGGACAATTCCAGAACCAGGTGGGACAACAAGCATGTTGCGGAAAGCATTAGATCCCC
 
. : . : . : . : . : . :
JMFS120F06+ ATTTAAGAAAGGCAAATCTTTCCTTGTTTCTCTGGAATTCAAGCTGCATATTAGCTTGGA
JMFS089B03+ ATTTAAGAAAGGCAAATCTTTCCTTGTTTCTCTGGAATTCAAGCTGCATATTAGCTTGGA
JMFS142F01+ ATTTAAGAAAGGCAAATCTTTCCTTGTTTCTCTGGAATTCAAGCTGCATATTAGCTTGGA
JMFS006A01+ ATTTAAGAAAGGCAAATCTTTCCTTGTTTCTCTGGAATTCAAGCTGCATATTAGCTTGGA
JMFS047C12+ ATTTAAGAAAGGCAAATCTTTCCTTGTTTCTCTGGAATTCAAGCTGCATATTAGCTTGGA
JMFS165H08+ ATTTAAGAAAGGCAAATCTTTCCTTGTTTCTCTGGAATTCAAGCTGCATATTAGCTTGGA
JMFS066E04+ ATNTAAGAAAGGCAAATCTTTCCTTGTTTCTCTGGAATTCAAGCTGCATATTAGCTTGGA
JMFS111A07+ ATTTAAGAAAGGCAAATCTTTCCTTGTTTCTCTGGAATTCAAGCTGCATATTAGCTTGGA
                      ____________________________________________________________
consensus ATTTAAGAAAGGCAAATCTTTCCTTGTTTCTCTGGAATTCAAGCTGCATATTAGCTTGGA
 
. : . : . : . : . : . :
JMFS120F06+ CTGCATTTTCTGACCTCGCAACATCAACTTGAACTGAGTGATCAATAACAAGATCTACAG
JMFS089B03+ CTGCATTTTCTGACCTCGCAACATCAACTTGAACTGAGTGATCAATAACAAGATCTACAG
JMFS142F01+ CTGCATTTTCTGACCTCGCAACATCAACTTGAACTGAGTGATCAATAACAAGATCTACAG
JMFS006A01+ CTGCATTTTCTGACCTCGCAACATCAACTTGAACTGAGTGATCAATAACAAGATCTACAG
JMFS047C12+ CTGCATTTTCTGACCTCGCAACATCAACTTGAACTGAGTGATCAATAACAAGATCTACAG
JMFS165H08+ CTGCATTTTCTGACCTCGCAACATCAACTTGAACTGAGTGATCAATAACAAGATCTACAG
JMFS066E04+ CTGCATTTTCTGACCTCGCAACATCAACTTGAACTGAGTGATCAATAACAAGATCTACAG
JMFS111A07+ CTGCATTTTCTGACCTCGCAACATCAACTTGAACTGAGTGATCAATAACAAGATCTACAG
JMFS012E01+ CTCGCAACATCAACTTGAACTGAGTGATCAATAACAAGATCTACAG
JMFS145C05+ CTCGCAACATCAACTTGAACTGAGTGATCAATAACAAGATCTACAG
JMFS107A09+ TGAACTGAGTGATCAATAACAAGATCTACAG
JMFS092E01+ TCAACTTGAACTGAGTGATCAATAACAAGATCTACAG
JMFS038A04+ CAACATCAACTTGAACTGAGTGATCAATAACAAGATCTACAG
JMFS108F09+ ACAG
                      ____________________________________________________________
consensus CTGCATTTTCTGACCTCGCAACATCAACTTGAACTGAGTGATCAATAACAAGATCTACAG
 
. : . : . : . : . : . :
JMFS120F06+ GAACCAGGGGGTTGATCTTGTCAGAATCACTGCCAA
JMFS089B03+ GAACCAGGGGGTTGATCTTGTCAGAATCACTGCCAAGGTTGTTCATAGCATCACGCATGC
JMFS142F01+ GAACCAGGGGGTTGATCTTGTCAGAATCACTGCCAAGGTTGTTCATAGCATCACGCATGC
JMFS006A01+ GAACCAGGGGGTTGATCTTGTCAGAATCACTGCCAAGGTTGTTCATAGCATCACGCATGC
JMFS047C12+ GAACCAGGGGGTTGATCTTGTCAGAATCACTGCCAAGGTTGTTCATAGCATCACGCATGC
JMFS165H08+ GAACCAGGGGGTTGATCTTGTCAGAATCACTGCCAAGGTTGTTCATAGCATCACGCATGC
JMFS066E04+ GAACCAGGGGGTTGATCTTGTCAGAATCACTGCCAAGGTTGTTCATAGCATCACGCATGC
JMFS111A07+ GAACCAGGGGGTTGATCTTGTCAGAATCACTGCCAAGGTTGTTCATAGCATCACGCATGC
JMFS023D02+ AATCACTGCCAAGGTTGTTCATAGCATCACGCATGC
JMFF039C14+ AATCACTGCCAAGGTTGTTCATAGCATCACGCATGC
JMFS012E01+ GAACCAGGGGGTTGATCTTGTCAGAATCACTGCCAAGGTTGTTCATAGCATCACGCATGC
JMFS145C05+ GAACCAGGGGGTTGATCTTGTCAGAATCACTGCCAAGGTTGTTCATAGCATCACGCATGC
JMFS107A09+ GAACCAGGGGGTTGATCTTGTCAGAATCACTGCCAAGGTTGTTCATAGCATCACGCATGC
JMFS092E01+ GAACCAGGGGGTTGATCTTGTCAGAATCACTGCCAAGGTTGTTCATAGCATCACGCATGC
JMFS038A04+ GAACCAGGGGGTTGATCTGGTCAGAATCACTGCCAAGGTTGTTCATAGCATCACGCATGC
JMFS108F09+ GAACCAGGGGGTTGATCTTGTCAGAATCACTGCCAAGGTTGTTCATAGCATCACGCATGC
JMFS075B04+ TGATCTTGTCAGAATCACTGCCAAGGTTGTTCATAGCATCACGCATGC
JMFS122B08+ TAGCATCACGCATGC
JMFS036F04+ GGTTGTTCATAGCATCACGCATGC
                      ____________________________________________________________
consensus GAACCAGGGGGTTGATCTTGTCAGAATCACTGCCAAGGTTGTTCATAGCATCACGCATGC
 
. : . : . : . : . : . :
JMFS089B03+ AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS142F01+ AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS006A01+ AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS047C12+ AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS165H08+ AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS066E04+ AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS111A07+ AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS023D02+ AAGCAAGGTCCACCACGGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFF039C14+ AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS012E01+ AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS145C05+ AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS107A09+ AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS092E01+ AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS038A04+ AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS108F09+ AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS075B04+ AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS122B08+ AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS114E03+ TGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS114E02+ GACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS159B05+ CAATAACACACGGGCTGGTT
JMFS036F04+ AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
JMFS056F06+ GTCTTGCAATAACACACGGGCTGGTT
                      ____________________________________________________________
consensus AAGCAAGGTCCACCACTGCTGGGACACCAGTAAAGTCTTGCAATAACACACGGGCTGGTT
 
. : . : . : . : . : . :
JMFS089B03+ TGAATGGTATCTCAACCAGCTTAGGAGCA
JMFS142F01+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS006A01+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS047C12+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS165H08+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS066E04+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS111A07+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS023D02+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFF039C14+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS012E01+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS145C05+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS107A09+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS092E01+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS038A04+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS108F09+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS075B04+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS122B08+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS114E03+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS114E02+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS159B05+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS036F04+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
JMFS056F06+ TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
                      ____________________________________________________________
consensus TGAATGGTATCTCAACCAGCTTAGGAGCAGAGTTTTCCCAGTCAATGATCTTATCAACAT
 
. : . : . : . : . : . :
JMFS142F01+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS006A01+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS047C12+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS165H08+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS066E04+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS111A07+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS023D02+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFF039C14+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS012E01+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS145C05+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS107A09+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS092E01+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS038A04+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS108F09+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS075B04+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS122B08+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS114E03+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS114E02+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS159B05+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS036F04+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS056F06+ CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS115F10+ TGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
JMFS054D07+ CAATTACGAATTGCTGATTCAAGAAGTATCCTAA
                      ____________________________________________________________
consensus CTTCCTTCTTCACTTGAAAATTGTCGCAATTACGAATTGCTGATTCAAGAAGTATCCTAA
 
. : . : . : . : . : . :
JMFS142F01+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS006A01+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTT
JMFS047C12+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS165H08+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS066E04+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS111A07+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS023D02+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFF039C14+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS012E01+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS145C05+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS107A09+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS092E01+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS038A04+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS108F09+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS075B04+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS122B08+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS114E03+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS114E02+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS159B05+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS036F04+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS056F06+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS115F10+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS054D07+ TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
JMFS019E03+ TCATTGAGAGCAGGAAGGCTATAGACCTTTC
                      ____________________________________________________________
consensus TAGAGTATGGCAGCTTATCAATCCGTGGATCATTGAGAGCAGGAAGGCTATAGAACTTTC
 
. : . : . : . : . : . :
JMFS142F01+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS047C12+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS165H08+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS066E04+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS111A07+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS023D02+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFF039C14+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS012E01+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS145C05+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS107A09+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS092E01+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS038A04+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS108F09+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS075B04+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS122B08+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS114E03+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS114E02+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS159B05+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS036F04+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS056F06+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS115F10+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS054D07+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
JMFS019E03+ CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
                      ____________________________________________________________
consensus CGAATTCACCCCCTCCTGGCTTGGGGAGACTGGTAAGGATTCCCTTGAACGGATTCTCAG
 
. : . : . : . : . : . :
JMFS142F01+ ATGCT
JMFS047C12+ ATGCTGAAGC
JMFS165H08+ ATGCTGAAGCCATTAGCACA
JMFS066E04+ ATGCTGAAGCCATTAGCACA
JMFS111A07+ ATGCTGAAGCCATTAGCACAAA
JMFS023D02+ ATGCTGAAGCCATTAGC--ACAAACAGAATATTAGATTTTCAGATTCGCAATTTCCCCTT
JMFF039C14+ ATGC
JMFS012E01+ ATGCCATAGTCGCGATCTTCCGATGGAAATCGCTCAAAACGGGAGAGGCGATCCTGATCT
JMFS145C05+ ATGCCATAGTCGCGATCTTCCGATGGAAATCGCTCAAAACGGGAGAGGCGATCCTGATCT
JMFS107A09+ ATGCCATAGTCGCGATCTTCCGATGGAAATCGCTCAAAACGGGAGAGGCGATCCTGATCT
JMFS092E01+ ATGCCATAGTCGCGATCTTCCGATGGAAATCGCTCAAAACGGGAGAGGCGATCCTGATCT
JMFS038A04+ ATGCCATAGTCGCGATCTTCCGATGGAAATCGCTCAAAACGGGAGAGGCGATCCTGATCT
JMFS108F09+ ATGCCATAGTCGCGATCTTCCGATGGAAATCGCTCAAAACGGGAGAGGCGATCCTGATCT
JMFS075B04+ ATGCCATAGTCGCGATCTTCCGATGGAAATCGCTCAAAACGGGAGAGGCGATCCTGATCT
JMFS122B08+ ATGCCATAGTCGCGATCTTCCGATGGAAATCGCTCAAAACGGGAGAGGCGATCCTGATCT
JMFS114E03+ ATGCCATAGTCGCGATCTTCCGATGGAAATCGCTCAAAACGGGAGAGGCGATCCTGATCT
JMFS114E02+ ATGCCATAGTCGCGATCTTCCGATGGAAATCGCTCAAAACGGGAGAGGCGATCCTGATCT
JMFS159B05+ ATGCCATAGTCGCGATCTTCCGATGGAAATCGCTCAAAACGGGAGAGGCGATCCTGATCT
JMFS036F04+ ATGCCATAGTCGCGATCTTCCGATGGAAATCGCTCAAAACGGGAGAGGCGATCCTGATCT
JMFS056F06+ ATGCCATAGTCGCGATCTTCCGATGGAAATCGCTCAAAACGGGAGAGGCGATCCTGATCT
JMFS115F10+ ATGCCATAGTCGCGATCTTCCGATGGAAATCGCTCAAAACGGGAGAGGCGATCCTGATCT
JMFS054D07+ ATGCCATAGTCGCGATCTTCCGATGGAAATCGCTCAAAACGGGAGAGGCGATCCTGATCT
JMFS019E03+ ATGCCATAGTCGCGATCTTCCGATGGAAATCGCTCAAAACGGGAGAGGCGATCCTGATCT
JMFS150G09+ GTCGCGATCTTCCGATGGAAATCGCTC-AAACGGGAGAGGCGATCCTGATCT
                      ____________________________________________________________
consensus ATGCCATAGTCGCGATCTTCCGATGGAAATCGCTCAAAACGGGAGAGGCGATCCTGATCT
 
. : . : . : . : . : . :
JMFS023D02+ GATAAGTCAG
JMFS116B03+ AGGCAGGGATAGCAGGTGACTTCCAATCAACACCGTGACTCCAGCGGGGCACGGAG
JMFS012E01+ GA-GAGGCAGGGATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
JMFS145C05+ GA-GAGGCAGGGATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
JMFS107A09+ GA-GAGGCAGGGATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
JMFS092E01+ GA-GAGGCAGGGATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
JMFS038A04+ GA-GAGGCAGGGATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
JMFS108F09+ GA-GAGGCAGGGATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
JMFS075B04+ GA-GAGGCAGGGATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
JMFS122B08+ GA-GAGGCAGGGATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
JMFS114E03+ GA-GAGGCAGGGATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
JMFS114E02+ GA-GAGGCAGGGATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
JMFS159B05+ GA-GAGGCAGGCATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
JMFS036F04+ GA-GAGGCAGGGATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
JMFS056F06+ GA-GAGGCAGGGATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
JMFS115F10+ GA-GAGGCAGGGATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
JMFS054D07+ GA-GAGGCAGGGATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
JMFS019E03+ GA-GAGGCAGGGATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
JMFS150G09+ GA-GAGGCAGGGATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
                      ____________________________________________________________
consensus GA-GAGGCAGGGATAGCAGGTGACTTCCAATCAACGCCGTGACTCCAGCGGGGCACGGAG
 
. : . : . : . : . : . :
JMFS116B03+ GAGCGGATCGATGGCAGAGCAGTCGACAAGCTCAACGTCCGATACTGCTGCTGGCGAACC
JMFS012E01+ GAACGGATCGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
JMFS145C05+ GAACGGATCGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
JMFS107A09+ GAACGGATCGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
JMFS092E01+ GAACGGATCGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
JMFS038A04+ GAACGGATCGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
JMFS108F09+ GAACGGATCGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
JMFS075B04+ GAACGGATCGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
JMFS122B08+ GAACGGATCGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
JMFS114E03+ GAACGGATCGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
JMFS114E02+ GAACGGATCGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
JMFS159B05+ GAACGGATCGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
JMFS036F04+ GAACGGATCGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
JMFS056F06+ GAACGGATCGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
JMFS115F10+ GAACGGATCGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
JMFS054D07+ GAACGGATCGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
JMFS019E03+ GAACGGATCGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
JMFS150G09+ GAACGGATTGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
                      ____________________________________________________________
consensus GAACGGATCGATCGCAGAGCAGACGAGAAGCTCAACGACCGATACTGCTGCTGGCGAAAC
 
. : . : . : . : . : . :
JMFS116B03+ GAAGGGCTCTGGTAGGT
JMFS012E01+ GAGGGGCTCTGGTAGGTTCTATA
JMFS145C05+ GAGGGGCTCTGGTAGGTTCTATAGAGCGGAGAAGCGGAAGA
JMFS107A09+ GAGGGGCTCTGGTAGGTTCTATAGAGCGGAGAAGCGGAAGAGAAGAAGCGTGAGCGG
JMFS092E01+ GAGGGGCTCTGGTAGGTTCTATAGAGCGGAGAAGCGGAAGAGAAGAAGCGT
JMFS038A04+ GAGGGGCTCTGGTAGGTTCTATAGAGCGGAGAAGCGGAAGAGAAGAAGCGTGAGCGG
JMFS108F09+ GAGGGGCTCTGGTAGGTTCTATAGAGCGGAGAAGCGGAAGAGAAGAAGCGTGAGCGGCAC
JMFS075B04+ GAGGGGCTCTGGTAGGTTCTATAGAGCGGAGAAGCGGAAGAGAAGAAGCGTGAGCGGCAC
JMFS122B08+ GAGGGGCTCTGGTAGGTTCTATAGAGCGGAGAAGCGGAAGAGAAGAAGCGTGAGCGGCAC
JMFS114E03+ GAGGGGCTCTGGTAGGTTCTATAGAGCGGAGAAGCGGAAGAGAAGAAGCGTGAGCGGCAC
JMFS114E02+ GAGGGGCTCTGGTAGGTTCTATAGAGCGGAGAAGCGGAAGAGAAGAAGCGTGAGCGGCAC
JMFS159B05+ GAGGGGCTCTGGTAGGTTCTATAGAGCGGAGAAGCGGAAGAGAAGCAGCGTGAGCGGCAC
JMFS036F04+ GAGGGGCTCTGGTAGGTTCTATAGAGCGGAGAAGCGGAAGAGAAGAAGCGTGAGCGGCAC
JMFS056F06+ GAGGGGCTCTGGTAGGTTCTATAGAGCGGAGAAGCGGAAGAGAAGAAGCGTGAGCGGCAC
JMFS115F10+ GAGGGGCTCTGGTAGGTTCTATAGAGCGGAGAAGCGGAAGAGAAGAAGCGTGAGCGGCAC
JMFS054D07+ GAGGGGCTCTGGTAGGTTCTATAGAGCGGAGAAGCGGAAGAGAAGAAGCGTGAGCGGCAC
JMFS019E03+ GAGGGGCTCTGGTAGGTTCTATAGAGCGGAGAAGCGGAAGAGAAGAAGCGTGAGCGGCAC
JMFS150G09+ GAGGGGCTCTGGTAGGTTCTATAGAGCGGAGAAGCGGAAGAGAAGAAGCGTGAGCGGCAC
                      ____________________________________________________________
consensus GAGGGGCTCTGGTAGGTTCTATAGAGCGGAGAAGCGGAAGAGAAGAAGCGTGAGCGGCAC
 
. : . : . : . : . : . :
JMFS108F09+ AATGCAGACGAGGAGCCTC
JMFS075B04+ AATGCAGACGAGGAGCCTCGCAAGAGTGAAGTGGCGGCCG
JMFS122B08+ AATGCAGACGAGGAGCCTCG
JMFS114E03+ AATGCAGACGA
JMFS114E02+ AATGCAGACGA
JMFS159B05+ AATGCAGACGAGGAG
JMFS036F04+ AATGCAGACGAGGAGCCTCGCAAGAGTGAAGTGGCGGCCGAGTAAGAAGAGTAGGA
JMFS056F06+ AATGCAGACGAGGAGCCTCGCAAGAGTGAAGTGGCGGCCGAGTAAGAAGAGTAGGAGCTT
JMFS115F10+ AATGCAGACGAGGAGCCTCGCAAGAGTGAAGTGGCGGCCGAGTAAGAAGAGTAGGAGCTT
JMFS054D07+ AATGCAGACGAGGAGCCTCGCAAGAGTGAAGTGGCGGCCGAGTAAGAAGAGTAGGAGCTT
JMFS019E03+ AATGCAGACGAGGAGCCTCGCAAGAGTGAAGTGGCGGCCGAGTAAGAAGAGTAGGAGCTT
JMFS150G09+ AATGCAGACGAGGAGCCTCGCAAGAGTGAAGTGGCGGCCGAGTAAGAAGAGTAGGAGCTT
                      ____________________________________________________________
consensus AATGCAGACGAGGAGCCTCGCAAGAGTGAAGTGGCGGCCGAGTAAGAAGAGTAGGAGCTT
 
. : . : . : . : . : . :
JMFS056F06+ ATATACATGATTAGCCGGGGCGTGTGTTTCAAACTTTCAATATCTCATCGAAAAATGATG
JMFS115F10+ ATATACATGATTAGCCGGGGCGTGTGTTTCAAACTTTCAATATCTCATCGAAAAATGATG
JMFS054D07+ ATATACATGATTAGCCGGGGCGTGTGTTTCAAACTTTCAATATCTCATCGAAAAATGATG
JMFS019E03+ ATATACATGATTAGCCGGGGCGTGTGTTTCAAACTTTCAATATCTCATCGAAAAATGATG
JMFS150G09+ ATATACATGATTAGCCGGGGCGTGTGTTTCAAACTTTCAATATCTCATCGAAAAATGATG
                      ____________________________________________________________
consensus ATATACATGATTAGCCGGGGCGTGTGTTTCAAACTTTCAATATCTCATCGAAAAATGATG
 
. : . : . : . : . : . :
JMFS056F06+ AT
JMFS115F10+ ATGTGGTAGGTAAGGCGCGGGTGTGGGTGTGGGACTGGGCGTGTGGTGGGCAGATACAGG
JMFS054D07+ ATGTGGTAGGTAAGGCGCGGGTGTGGGTGTGGGACTGGGCGTGTGGTGGGCAGATACAGG
JMFS019E03+ ATGTGGTAGGTAAGGCGCGGGTGTGGGTGTGGGACTGGGCGTGTGGTGGGCAGATACAGG
JMFS150G09+ ATGTGGTAGGTAAGGCGCGGGTGTGGGTGTGGGACTGGGCGTGTGGTGGGCAGATACAGG
                      ____________________________________________________________
consensus ATGTGGTAGGTAAGGCGCGGGTGTGGGTGTGGGACTGGGCGTGTGGTGGGCAGATACAGG
 
. : . : . : . : . : . :
JMFS115F10+ ATCGCGTGCGTGGCGAGGGGTGGGGTGGGCGGGTGGGTTTC
JMFS054D07+ ATCGCGTGCGTGGCGAGGGGTGGGGTGGGCGGGTGGGTTTCTCGGTTTGCG
JMFS019E03+ ATCGCGTGCGTGGCGAGGGGTGGGGTGGGCGGGTGGGTTTCTCGGTTTGCGTGCCGTAAT
JMFS150G09+ ATCGCGTGCGTGGCGAGGGGTGGGGTGGGCGGGTGGGTTTCTCGGTTTGCGTGCCGTAAT
                      ____________________________________________________________
consensus ATCGCGTGCGTGGCGAGGGGTGGGGTGGGCGGGTGGGTTTCTCGGTTTGCGTGCCGTAAT
 
. : . : . : . : . : . :
JMFS019E03+ TCTGGAAAGGGAAAACAGAAGAAGAA
JMFS150G09+ TCTGGAAAGGGAAAACAGAAGAAGAAGGTATTTGCGTGTGGCAATGAAGGAGATGCTATG
                      ____________________________________________________________
consensus TCTGGAAAGGGAAAACAGAAGAAGAAGGTATTTGCGTGTGGCAATGAAGGAGATGCTATG
 
. : . : . : . : . : . :
JMFS150G09+ TATGTATGAATGTATACAACATCAAAGGAATTACCGAATTGGAGAGAATAGTGGAGATTG
                      ____________________________________________________________
consensus TATGTATGAATGTATACAACATCAAAGGAATTACCGAATTGGAGAGAATAGTGGAGATTG