Previous Contig 004121:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006B18Sequence572004121 (21)gb:NTA299256_16913281e-86Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).755004121 (21)gb:NTA299256_16913282e-88Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).
JMFF008O04Sequence603004121 (21)gb:NTA299256_16913285e-88Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).733004121 (21)gb:NTA299256_16913283e-83Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).
JMFF027G16Sequence733004121 (21)gb:NTA299256_16913281e-97Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).
JMFF028N20Sequence558004121 (21)gb:NTA299256_16913287e-84Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).704004121 (21)gb:NTA299256_16913284e-75Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).
JMFF040P24Sequence571004121 (21)gb:NTA299256_16913285e-81Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).768004121 (21)gb:NTA299256_16913283e-92Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).
JMFF046P12Sequence491004121 (21)gb:NTA299256_16913282e-71Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).485004121 (21)gb:NTA299256_16913283e-32Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).
JMFF047O11Sequence484004121 (21)gb:NTA299256_16913281e-70Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).464004121 (21)gb:NTA299256_16913285e-36Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).
JMFN003F01Sequence627004121 (21)gb:NTA299256_16913282e-95Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).
JMFN008B15Sequence565004121 (21)gb:AJ843126_18145112e-48Plantago major mRNA for malate dehydrogenase (mdh1 gene).
JMFN010C08Sequence615004121 (21)gb:NTA299256_16913282e-93Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).
JMFN012I22Sequence583004121 (21)gb:AJ843126_18145112e-45Plantago major mRNA for malate dehydrogenase (mdh1 gene).
JMFN012K03Sequence616004121 (21)gb:NTA299256_1691328e-106Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).
JMFS062H04Sequence627004121 (21)gb:NTA299256_16913287e-92Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).
JMFS150E02Sequence522004121 (21)gb:NTA299256_16913288e-71Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).
JMSF023C21Sequence630019287gb:BT010479_16404250.032Arabidopsis thaliana At2g42560 gene, complete cds.741004121 (21)gb:NTA299256_16913281e-88Nicotiana tabacum mRNA for malate dehydrogenase (md1 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF046P12- ACTTAACAAAGTGTAGTTCAAATTAGG
JMFN012I22- ACTAGTCTCGAGXXXXXXXXXXXXXXXXXXXACTTAACAAAGTGTAGTTCAAATTAGG
JMFN008B15+ ACTTAACAAAGTGTAGTTCAAATTAGG
rJMFF006B18- G
                      ____________________________________________________________
consensus ACTAGTCTCGAGNNNNNNNNNNNNNNNNNNNACTTAACAAAGTGTAGTTCAAATTAGG
 
. : . : . : . : . : . :
rJMFF046P12- AAACCATTGGAGCAAGCAAAGTGTACTCATCAATTACACAAAGCGAACTAAATTCAGTCA
JMFN012I22- AAACCATTGGAGCAAGCAAAGTGTACTCATCAATTACACAAAGCGAACTAAATTCAGTCA
rJMFF047O11- GGAGCAAGCAAAGTGTACTCATCAATTACACACAGCGAACTAAATTCAGTCA
JMFN008B15+ AAACCATTGGAGCAAGCAAAGTGTACTCATCAATTACACAAAGCGAACTAAATTCAGTCA
rJMFF006B18- AAACCATTGGAGCAAGCAAAGTGTACTCATCAATTACACAAAGCGAACTAAATTCAGTCA
rJMSF023C21- AAGTGTACTCATCAATTACACAAAGCGAACTAAATTCAGTCA
rJMFF028N20- GAGCAAGCAAAGTGTACTCATCAATTACACAAAGCGAACTAAATTCAGTCA
rJMFF040P24- AACCATTGGAGCAAGCAAAGTGTACTCATCAATTACACAAAGCGAACTAAATTCAGTCA
rJMFF008O04- AAAGCGAACTAAATTCAGTCA
                      ____________________________________________________________
consensus AAACCATTGGAGCAAGCAAAGTGTACTCATCAATTACACAAAGCGAACTAAATTCAGTCA
 
. : . : . : . : . : . :
rJMFF046P12- CCTCTCAAATCAAGAAAAATAGAAAGGTGTAACATCAACAAAAACCCTCACAGAAGCACC
JMFN012I22- CCTCTCAAATCAAGAAAAATAGAAAGGTGTAACATCAACAAAAACCCTCACAGAAGCACC
rJMFF047O11- CCTCTCAAATCAAGAAAAATAGAAAGGTGTAACATCAACAAAAACCCTCACAGAAGCACC
JMFN008B15+ CCTCTCAAATCAAGAAAAATAGAAAGGTGTAACATCAACAAAAACCCTCACAGAAGCACC
rJMFF006B18- CCTCTCAAATCAAGAAAAATAGAAAGGTGTAACATCAACAAAAACCCTCACAGAAGCACC
rJMSF023C21- CCTCTCAAATCAAGAAAAATAGAAAGGTGTAACATCAACAAAAACCCTCACAGAAGCACC
rJMFF028N20- CCTCTCAAATCAAGAAAAATAGAAAGGTGTAACATCAACAAAAACCCTCACAGAAGCACC
rJMFF040P24- CCTCTCAAATCAAGAAAAATAGAAAGGTGTAACATCAACAAAAACCCTCACAGAAGCACC
rJMFF008O04- CCTCTCAAATCAAGAAAAATAGAAAGGTGTAACATCAACAAAAACCCTCACAGAAGCACC
rJMFF027G16- TCAAGAAAAATAGAAAGGTGTAACATCAACAAAAACCCTCACAGAAGCACC
                      ____________________________________________________________
consensus CCTCTCAAATCAAGAAAAATAGAAAGGTGTAACATCAACAAAAACCCTCACAGAAGCACC
 
. : . : . : . : . : . :
rJMFF046P12- ATGTGCATATCCATGACTTTATTCAGAACTGCAGCAATGTATTAATACCTCGAGGTCGCA
JMFN012I22- ATGTGCATATCCATGACTTTATTCAGAACTGCAGCAATGTATTAATACCTCGAGGTCGCA
rJMFF047O11- ATGTGCATATCCATGACTTTATTCAAAACTGCAGCAATGTATTAATACCTCGAGGTCGCA
JMFN008B15+ ATGTGCATATCCATGACTTTATTCAGAACTGCAGCAATGTATTAATACCTCGAGGTCGCA
rJMFF006B18- ATGTGCATATCCATGACTTTATTCAGAACTGCAGCAATGTATTAATACCTCGAGGTCGCA
rJMSF023C21- ATGTGCATATCCATGACTTTATTCAGAACTGCAGCAATGTATTAATACCTCGAGGTCGCA
rJMFF028N20- ATGTGCATATCCATGACTTTATTCAGAACTGCAGCAATGTATTAATACCTCGAGGTCGCA
rJMFF040P24- ATGTGCATATCCATGACTTTATTCAGAACTGCAGCAATGTATTAATACCTCGAGGTCGCA
rJMFF008O04- ATGTGCATATCCATGACTTTATTCAGAACTGCAGCAATGTATTAATACCTCGAGGTCGCA
rJMFF027G16- ATGTGCATATCCATGACTTTATTCAGAACTGCAGCAATGTATTAATACCTCGAGGTCGCA
                      ____________________________________________________________
consensus ATGTGCATATCCATGACTTTATTCAGAACTGCAGCAATGTATTAATACCTCGAGGTCGCA
 
. : . : . : . : . : . :
rJMFF046P12- AGATCTCGATCTATCTCGATTAGGCGGGATTTGTATCTTAAGAAAGACACGAGTATGCCA
JMFN012I22- AGATCTCGATCTATCTCGATTAGGCGGGATTTGTATCTTAAGAAAGACACGAGTATGCCA
rJMFF047O11- AGATCTCGATCTATCTCGATTAGGCGGGATTTGTATCTTAAGAAAGACACGAGTATGCCA
JMFN008B15+ AGATCTCGATCTATCTCGATTAGGCGGGATTTGTATCTTAAGAAAGACACGAGTATGCCA
rJMFF006B18- AGATCTCGATCTATCTCGATTAGGCGGGATTTGTATCTTAAGAAAGACACGAGTATGCCA
rJMSF023C21- AGATCTCGATCTATCTCGATTAGGCGGGATTTGTATCTTAAGAAAGACACGAGTATGCCA
rJMFF028N20- AGATCTCGATCTATCTCGATTAGGCGGGATTTGTATCTTAAGAAAGACACGAGTATGCCA
rJMFF040P24- AGATCTCGATCTATCTCGATTAGGCGGGATTTGTATCTTAAGAAAGACACGAGTATGCCA
rJMFF008O04- AGATCTCGATCTATCTCGATTAGGCGGGATTTGTATCTTAAGAAAGACACGAGTATGCCA
rJMFF027G16- AGATCTCGATCTATCTCGATTAGGCGGGATTTGTATCTTAAGAAAGACACGAGTATGCCA
                      ____________________________________________________________
consensus AGATCTCGATCTATCTCGATTAGGCGGGATTTGTATCTTAAGAAAGACACGAGTATGCCA
 
. : . : . : . : . : . :
rJMFF046P12- GAGCCTTTTCCTCGGAGAGCTCTTCCGCAGTTGCGTCCATCTTCTTCCTTGAGAACTCGT
JMFN012I22- GAGCCTTTTCCTCGGAGAGCTCTTCCGCAGTTGCGTCCATCTTCTTCCTTGAGAACTCGT
rJMFF047O11- GAGCCTTTTCCTCGGAGAGCTCTTCCGCAGTTGCGTCCATCTTCTTCCTTGAGAACTCGT
JMFN008B15+ GAGCCTTTTCCTCGGAGAGCTCTTCCGCAGTTGCGTCCATCTTCTTCCTTGAGAACTCGT
rJMFF006B18- GAGCCTTTTCCTCGGAGAGCTATTCCGCAGTTGCGTCCATCTTCTTCCTTGAGAACTCGT
rJMSF023C21- GAGCCTTTTCCTCGGAGAGCTCTTCCGCAGTTGCGTCCATCTTCTTCCTTGAGAACTCGT
rJMFF028N20- GAGCCTTTTCCTCGGAGAGCTCTTCCGCAGTTGCGTCCATCTTCTTCCTTGAGAACTCGT
rJMFF040P24- GAGCCTTTTCCTCGGAGAGCTCTTCCGCAGTTGCGTCCATCTTCTTCCTTGAGAACTCGT
rJMFF008O04- GAGCCTTTTCCTCGGAGAGCTCTTCCGCAGTTGCGTCCATCTTCTTCCTTGAGAACTCGT
rJMFF027G16- GAGCCTTTTCCTCGGAGAGCTCTTCCGCAGTTGCGTCCATCTTCTTCCTTGAGAACTCGT
                      ____________________________________________________________
consensus GAGCCTTTTCCTCGGAGAGCTCTTCCGCAGTTGCGTCCATCTTCTTCCTTGAGAACTCGT
 
. : . : . : . : . : . :
rJMFF046P12- CGATAGGAAGACCTTGGACAATGCACCATTCTCCGTTTTTGCAAGTAACTGGGAAGGAAT
JMFN012I22- CGATAGGAAGACCTTGGACAATGCACCATTCTCCGTTTTTGCAAGTAACTGGGAAGGAAT
rJMFF047O11- CGATAGGAAGACCTTGGACAATGCACCATTCTCCGTTTTTGCAAGTAACTGGGAAGGAAT
JMFN008B15+ CGATAGGAAGACCTTGGACAATGCACCATTCTCCGTTTTTGCAAGTAACTGGGAAGGAAT
rJMFF006B18- CGATAGGAAGACCTTGGACAATGCACCATTCTCCGTTTTTGCAAGTAACTGGGAAGGAAT
rJMSF023C21- CGATAGGAAGACCTTGGACAATGCACCATTCTCCGTTTTTGCAAGTAACTGGGAAGGAAT
rJMFF028N20- CGATAGGAAGACCTTGGACAATGCACCATTCTCCGTTTTTGCAAGTAACTGGGAAGGAAT
rJMFF040P24- CGATAGGAAGACCTTGGACAATGCACCATTCTCCGTTTTTGCAAGTAACTGGGAAGGAAT
rJMFF008O04- CGATAGGAAGACCTTGGACAATGCACCATTCTCCGTTTTTGCAAGTAACTGGGAAGGAAT
rJMFF027G16- CGATAGGAAGACCTTGGACAATGCACCATTCTCCGTTTTTGCAAGTAACTGGGAAGGAAT
                      ____________________________________________________________
consensus CGATAGGAAGACCTTGGACAATGCACCATTCTCCGTTTTTGCAAGTAACTGGGAAGGAAT
 
. : . : . : . : . : . :
rJMFF046P12- AAATTAGTCCAGCCGGGACATTGTACGAGCCATCAGAGTATACACCCATGGATACCCAAG
JMFN012I22- AAATTAGTCCAGCCGGGACATTGTACGAGCCATCAGAGTATACACCCATGGATACCCAAG
rJMFF047O11- AAATTAGTCCAGCCGGGACATTGTACGAGCCATCAGAGTATACACCCATGGATACCCAAG
JMFN008B15+ AAATTAGTCCAGCCGGGACATTGTACGAGCCATCAGAGTATACACCCATGGATACCCAAG
rJMFF006B18- AAATTAGTCCAGCCGGGACATTGTACGAGCCATCAGAGTATACACCCATGGATACCCAAG
rJMSF023C21- AAATTAGTCCAGCCGGGACATTGTACGAGCCATCAGAGTATACACCCATGGATACCCAAG
rJMFF028N20- AAATTAGTCCAGCCGGGACATTGTACGAGCCATCAGAGTATACACCCATGGATACCCAAG
rJMFF040P24- AAATTAGTCCAGCCGGGACATTGTACGAGCCATCAGAGTATACACCCATGGATACCCAAG
rJMFF008O04- AAATTAGTCCAGCCGGGACATTGTACGAGCCATCAGAGTATACACCCATGGATACCCAAG
rJMFF027G16- AAATTAGTCCAGCCGGGACATTGTACGAGCCATCAGAGTATACACCCATGGATACCCAAG
                      ____________________________________________________________
consensus AAATTAGTCCAGCCGGGACATTGTACGAGCCATCAGAGTATACACCCATGGATACCCAAG
 
. : . : . : . : . : . :
rJMFF046P12- TTCCCTCCG
JMFN012I22- TTCCCTCCGGAGTTCCAAGCACCCAGTCACGTATGTGGTCGCAAGCAGAACTAGCAGCAG
rJMFF047O11- TTCCCTCCGGAGNTCCCAGCACCCAGT
JMFN008B15+ TTCCCTCCGGAGTTCCAAGCACCCAGTCACGTATGTGGTCGCAAGCAGAACTAGCAGCAG
rJMFF006B18- TTCCCTCCGGAGTTCCAAGCACCCAGTCACGTATGTGGTCGCAAGCAGAACTAGCAGCAG
rJMSF023C21- TTCCCTCCGGAGTTCCAAGCACCCAGTCACGTATGTGGTCGCAAGCAGAACTAGCAGCAG
rJMFF028N20- TTCCCTCCGGAGTTCCAAGCACCCAGTCACGT-GGTGGTCGCAAGCAGAACTAGCAGCAG
rJMFF040P24- TTCCCTCCGGAGTTCCAAGCACCCAGTCACGTATGTGGTCGCAAGCAGAACTAGCAGCAG
rJMFF008O04- TTCCCTCCGGAGTTCCAAGCACCCAGTCACGTATGTGGTCGCAAGCAGAACTAGCAGCAG
rJMFF027G16- TTCCCTCCGGAGTTCCAAGCACCCAGTCACGTATGTGGTCGCAAGCAGAACTAGCAGCAG
                      ____________________________________________________________
consensus TTCCCTCCGGAGTTCCAAGCACCCAGTCACGTATGTGGTCGCAAGCAGAACTAGCAGCAG
 
. : . : . : . : . : . :
JMFN012I22- AAAGGGCGCTGGAGAATTTTCTAGCCTTAATAATTGCAGCACCGC
JMFN008B15+ AAAGGGCGCTGGAGAATTTTCTAGCCTTAATAATTGCAGCACCGCGCTGCTGGACAGT
rJMFF006B18- AAAGGGCGCTGGAGAATTTTCTAGCCTTAATAATTGCAGCACCGCGCTGCTGGACAGTGG
rJMSF023C21- AAAGGGCGCTGGAGAATTTTCTAGCCTTAATAATTGCAGCACCGCGCTGCTGGACAGTGG
rJMFF028N20- AAAGGGCGCTGGAGAATTTTCTAGCCTTAATAATTGCAGCACCGCGCTGCTGGACAGTGG
rJMFF040P24- AAAGGGCGCTGGAGAATTTTCTAGCCTTAATAATTGCAGCACCGCGCTGCTGGACAGTGG
rJMFF008O04- AAAGGGCGCT-GAGAATTTTCTAGCCTTAATAATTGCAGCACCGCGCTGCTGGGCAGTGG
rJMFF027G16- AAAGGGCGCTGGAGAATTTTCTAGCCTTAATAATTGCAGCACCGCGCTGCTGGACAGTGG
                      ____________________________________________________________
consensus AAAGGGCGCTGGAGAATTTTCTAGCCTTAATAATTGCAGCACCGCGCTGCTGGACAGTGG
 
. : . : . : . : . : . :
rJMFF006B18- TTATAAACTCCCCGTTCAACCATTCGTCATTGGCAACAAGCTCTCGGACAGGCCTTTCAC
rJMSF023C21- TTATAAACTCCCCGTTCAACCATTCGTCATTGGCAACAAGCTCTCGGACAGGCCTTTCAC
rJMFF028N20- TTATAAACTCCCCGTTCAACCATTCGTCATTGGCAACAAGCTCTCGGACAGGCCTTTCAC
rJMFF040P24- TTATAAACTCCCCGTTCAACCATTCGTCATTGGCAACAAGCTCTCGGACAGGCCTTTCAC
rJMFF008O04- TTATAAACTCCCCGTTCAACCATTCGTCATTGGCAACAAGCTCTCGGACAGGCCTTTCAC
rJMFF027G16- TTATAAACTCCCCGTTCAACCATTCGTCATTGGCAACAAGCTCTCGGACAGGCCTTTCAC
                      ____________________________________________________________
consensus TTATAAACTCCCCGTTCAACCATTCGTCATTGGCAACAAGCTCTCGGACAGGCCTTTCAC
 
. : . : . : . : . : . :
rJMFF006B18- CAGCTGGTGTTTTCACAGTTGCGTGATTGACATCAGGATACTGCGACGATGAGTGGTTTC
rJMSF023C21- CAGCTGGTGTTTTCACAGTTGCGTGATTGACATCAGGATACTGCGACGATGAGTGGTTTC
rJMFF028N20- CAGCTGGTGTTTTCACAGTTGCGTGATTGACATCAGGATACTGCGACGATGAGTGGTTTC
rJMFF040P24- CAGCTGGTGTTTTCACAGTTGCGTGATTGACATCAGGATACTGCGACGATGAGTGGTTTC
rJMFF008O04- CAGCTGGTGTTTTCACAGTTGCGTGATTGACATCAGGATACTGCGACGATGAGTGGTTTC
rJMFF027G16- CAGCTGGTGTTTTCACAGTTGCGTGATTGACATCAGGATACTGCGACGATGAGTGGTTTC
JMFN012K03+ GTGATTGACATCAGGATACTGCGACGATGAGTGGTTTC
JMFN003F01+ TGCGACGATGAGTGGTTTC
                      ____________________________________________________________
consensus CAGCTGGTGTTTTCACAGTTGCGTGATTGACATCAGGATACTGCGACGATGAGTGGTTTC
 
. : . : . : . : . : . :
rJMFF006B18- CCCATATTATAACGTTTTTAACGTCACTCACTTGAACATTCAATCTCTCTGAGATTTGAC
rJMSF023C21- CCCATATTATAACGTTTTTAACGTCACTCACTTGAACATTCAATCTCACTGAGATTTGAC
rJMFF028N20- CCCATATTATAACGTTTTTAACGTCACTCACTTGAACATTCAATCTCTCTGAGA
rJMFF040P24- CCCATATTATAACGTTTTTAACGTCACTCACTTGAACATTCAATCTCTCTGAGATTTGAC
rJMFF008O04- CCCATATTATAACGTTTTTAACGTCACTCACTTGAACATTCAA--TCTCTGAGATTTGAC
rJMFF027G16- CCCATATTATAACGTTTTTAACGTCACTCACTTGAACATTCAATCTCTCTGAGATTTGAC
JMFN012K03+ CCCATATTATAACGTTTTTAACGTCACTCACTTGAACATTCAATCTCTCTGAGATTTGAC
JMFN003F01+ CCCATATTATAACGTTTTTAACGTCACTCACTTGAACATTCAATCTCTCTGAGATTTGAC
JMFF008O04+ ACGTCACTCACTTGAACATTCAA--TCTNTGAGATTTGAC
JMFF006B18+ GAC
JMFN010C08+ AACGTCACTCACTTGAACATTCAATCTCTCTGAGATTTGAC
JMFS062H04+ TCACTTGAACATTCAATCTCTCTGAGATTTGAC
                      ____________________________________________________________
consensus CCCATATTATAACGTTTTTAACGTCACTCACTTGAACATTCAATCTCTCTGAGATTTGAC
 
. : . : . : . : . : . :
rJMFF006B18- CGAGGGCCCTGTTATGGTCCAACCTAGTCAGGCA
rJMSF023C21- CGAGGGCCCTGTTATGGTCCAACCTAGTCAGGCAA
rJMFF040P24- CGAGGGCCCTGTTATGGTCCAACCTAGTCAGGCAAGAAATGTTCTTCTC
rJMFF008O04- CGAGGGCCCTGTTATGGTCCAACCTAGTCAGGCAAGAAATGTTCTTCTCGGGAAT
rJMFF027G16- CGAGGGCCCTGTTATGGTCCAACCTAGTCAGGCAAGAAATGTTCTTCTCGGGAATAGACG
JMFN012K03+ CGAGGGCCCTGTTATGGTCCAACCTAGTCAGGCAAGAAATGTTCTTCTCGGGAATAGACG
JMFN003F01+ CGAGGGCCCTGTTATGGTCCAACCTAGTCAGGCAAGAAATGTTCTTCTCGGGAATAGACG
JMFF008O04+ CGAGGGCCCTGTTATGGTCCAACCTAGTCAGGCAAGAAATGTTCTTCTCGGGAATAGACG
JMFF028N20+ CTGTTATGGTCCAACCTAGTCAGGCAAGAAATGTTCTTCTCGGGAATAGACG
JMFF006B18+ CGAGGGCCCTGTTATGGTCCAACCTAGTCAGGCAAGAAATGTTCTTCTCGGGAATAGACG
JMFN010C08+ CGAGGGCCCTGTTATGGTCCAACCTAGTCAGGCAAGAAATGTTCTTCTCGGGAATAGACG
JMFS062H04+ CGAGGGCCCTGTTATGGTCCAACCTAGTCAGGCAAGAAATGTTCTTCTCGGGAATAGACG
JMFF040P24+ CTAGTCAGGCAAGAAATGTTCTTCTCGGGAATAGACG
                      ____________________________________________________________
consensus CGAGGGCCCTGTTATGGTCCAACCTAGTCAGGCAAGAAATGTTCTTCTCGGGAATAGACG
 
. : . : . : . : . : . :
rJMFF027G16- GTGCAAATTCCTTCNAGATCAA
JMFN012K03+ GTGCAAATTCCTTCAAGATCAATGCATTAGTATTTGCAGGGTTAGCAACAACCAACACCT
JMFN003F01+ GTGCAAATTCCTTCAAGATCAATGCATTAGTATTTGCAGGGTTAGCAACAACCAACACCT
JMFF008O04+ GTGCAAATTCCTTCAAGATCAATGCATTAGTATTTGCAGGGTTAGCAACAACCAACACCT
JMFF028N20+ GTGCAAATTCCTTCAAGATCAATGCATTAGTATTTGCAGGGTTAGCAACAACCAACACCT
JMFF046P12+ AAGATCAATGCATTAGTATTTGCAGGGTTAGCAACAACCAACACCT
JMFF047O11+ TCAAGATCAATGCATTAGTATTGNCAGGGTTAGCAACAACCAACACCT
JMFF006B18+ GTGCAAATTCCTTCAAGATCAATGCATTAGTATTTGCAGGGTTAGCAACAACCAACACCT
JMFN010C08+ GTGCAAATTCCTTCAAGATCAATGCATTAGTATTTGCAGGGTTAGCAACAACCAACACCT
JMFS062H04+ GTGCAAATTCCTTCAAGATCAATGCATTAGTATTTGCAGGGTTAGCAACAACCAACACCT
JMFF040P24+ GTGCAAATTCCTTCAAGATCAATGCATTAGTATTTGCAGGGTTAGCAACAACCAACACCT
JMFS150E02+ TCAATGCATTAGTATTTGCAGGGTTAGCAACAACCAACACCT
                      ____________________________________________________________
consensus GTGCAAATTCCTTCAAGATCAATGCATTAGTATTTGCAGGGTTAGCAACAACCAACACCT
 
. : . : . : . : . : . :
JMFN012K03+ TGCAGTTAGCAGCAGCGTGTTTCTCGAGAGCAGAAGCTTGAGACTTGTAGATAGAAACAT
JMFN003F01+ TGCAGTTAGCAGCAGCGTGTTTCTCGAGAGCAGAAGCTTGAGACTTGTAGATAGAAACAT
JMFF008O04+ TGCAGTTAGCAGCAGCGTGTTTCTCGAGAGCAGAAGCTTGAGACTTGTAGATAGAAACAT
JMFF028N20+ TGCAGTTAGCAGCAGCGTGTTTCTCGAGAGCAGAAGCTTGAGACTTGTAGATAGAAACAT
JMFF046P12+ TGCAGTTAGCAGCAGCGTGTTTCTCGAGAGCAGAAGCTTGAGACTTGTAGATAGAAACAT
JMFF047O11+ TGCAGTTAGCAGCAGCGTGTTTCTCGAGAGCAGAAGCTTGAGACTNGTAGATAGAAACAT
JMFF006B18+ TGCAGTTAGCAGCAGCGTGTTTCTCGAGAGCAGAAGCTTGAGACTTGTAGATAGAAACAT
JMFN010C08+ TGCAGTTAGCAGCAGCGTGTTTCTCGAGAGCAGAAGCTTGAGACTTGTAGATAGAAACAT
JMFS062H04+ TGCAGTTAGCAGCAGCGTGTTTCTCGAGAGCAGAAGCTTGAGACTTGTAGATAGAAACAT
JMFF040P24+ TGCAGTTAGCAGCAGCGTGTTTCTCGAGAGCAGAAGCTTGAGACTTGTAGATAGAAACAT
JMFS150E02+ TGCAGTTAGCAGCAGCGTGTTTCTCGAGAGCAGAAGCTTGAGACTTGTAGATAGAAACAT
                      ____________________________________________________________
consensus TGCAGTTAGCAGCAGCGTGTTTCTCGAGAGCAGAAGCTTGAGACTTGTAGATAGAAACAT
 
. : . : . : . : . : . :
JMFN012K03+ TCTTTGACATAACGTCTTTCCTCTCCATGCCTTCTTTTCTTGGAAAACCACCGACCATGA
JMFN003F01+ TCTTTGACATAACGTCTTTCCTCTCCATGCCTTCTTTTCTTGGAAAACCACCGACCATGA
JMFF008O04+ TCTTTGACATAACGTCTTTCCTCTCCATGCCTTCTTTTCTTGGAAAACCACCGACCATGA
JMFF028N20+ TCTTTGACATAACGTCTTTCCTCTCCATGCCTTCTTTTCTTGGAAAACCACCGACCATGA
JMFF046P12+ TCTTTGACATAACGTCTTTCCTCTCCATGCCTTCTTTTCTTGGAAAACCACCGACCATGA
JMFF047O11+ TCTTTGACATAACGTCTTTCCTCTCCATGCCTTCTTTTCTTGGAAAACCACCGACCATGA
JMFF006B18+ TCTTTGACATAACGTCTTTCCTCTCCATGCCTTCTTTTCTTGGAAAACCACCGACCATGA
JMFN010C08+ TCTTTGACATAACGTCTTTCCTCTCCATGCCTTCTTTTCTTGGAAAACCACCGACCATGA
JMFS062H04+ TCTTTGACATAACGTCTTTCCTCTCCATGCCTTCTTTTCTTGGAAAACCACCGACCATGA
JMFF040P24+ TCTTTGACATAACGTCTTTCCTCTCCATGCCTTCTTTTCTTGGAAAACCACCGACCATGA
JMFS150E02+ TCTTTGACATAACGTCTTTCCTCTCCATGCCTTCTTTTCTTGGAAAACCACCGACCATGA
                      ____________________________________________________________
consensus TCTTTGACATAACGTCTTTCCTCTCCATGCCTTCTTTTCTTGGAAAACCACCGACCATGA
 
. : . : . : . : . : . :
JMFN012K03+ CTGCAACATTGACACCAGTACATGCCTCGACAGCATCGGTTGTAGCAACAACACCTTTGA
JMFN003F01+ CTGCAACATTGACACCAGTACATGCCTCGACAGCATCGGTTGTAGCAACAACACCTTTGA
JMFF008O04+ CTGCAACATTGACACCAGTACATGCCTCGACAGCATCGGTTGTAGCAACAACACCTTTGA
JMFF028N20+ CTGCAACATTGACACCAGTACATGCCTCGACAGCATCGGTTGTAGCAACAACACCTTTGA
JMFF046P12+ CTGCAACATTGACACCAGTACATGCCTCGACAGCATCGGTTGTAGCAACAACACCTTTGA
JMFF047O11+ CTGCAACATTGACACCAGTACATGCCTCGACAGCATCGGTTGTAGCAACAACACCTTTGA
JMFF006B18+ CTGCAACATTGACACCAGTACATGCCTCGACAGCATCGGTTGTAGCAACAACACCTTTGA
JMFN010C08+ CTGCAACATTGACACCAGTACATGCCTCGACAGCATCGGTTGTAGCAACAACACCTTTGA
JMFS062H04+ CTGCAACATTGACACCAGTACATGCCTCGACAGCATCGGTTGTAGCAACAACACCTTTGA
JMFF040P24+ CTGCAACATTGACACCAGTACATGCCTCGACAGCATCGGTTGTAGCAACAACACCTTTGA
JMFS150E02+ CTGCAACATTGACACCAGTACATGCCTCGACAGCATCGGTTGTAGCAACAACACCTTTGA
                      ____________________________________________________________
consensus CTGCAACATTGACACCAGTACATGCCTCGACAGCATCGGTTGTAGCAACAACACCTTTGA
 
. : . : . : . : . : . :
JMFN012K03+ GAAGTGGGAAAGCGGCGTCAACTAATTCCATCTTGACTCCATTCAACGCCTCTGCAGCAG
JMFN003F01+ GAAGTGGGAAAGCGGCGTCAACTAATTCCATCTTGACTCCATTCAACGCCTCTGCAGCAG
JMFF008O04+ GAAGTGGGAAAGCGGCGTCAACTAATTCCATCTTGACTCCATTCAACGCCTCTGCAGCAG
JMFF028N20+ GAAGTGGGAAAGCGGCGTCAAATAATTCCATCTTGACTCCATTCAACGCCTCTGCAGCAG
JMFF046P12+ GAAGTGGGAAAGCGGCGTCAACTAATTCCATCTTGACTCCATTCAACGCCTCTGCAGCAG
JMFF047O11+ GAAGTGGGAAAGCGGCGTCAACTAATTCCATCTTGACTCCATTCAACGCCTCTGCAGCAG
JMFF006B18+ GAAGTGGGAAAGCGGCGTCAACTAATTCCATCTTGACTCCATTCAACGCCTCTGCAGCAG
JMFN010C08+ GAAGTGGGAAAGCGGCGTCAACTAATTCCATCTTGACTCCATTCAACGCCTCTGCAGCAG
JMFS062H04+ GAAGTGGGAAAGCGGCGTCAACTAATTCCATCTTGACTCCATTCAACGCCTCTGCAGCAG
JMFF040P24+ GAAGTGGGAAAGCGGCGTCAACTAATTCCATCTTGACTCCATTCAACGCCTCTGCAGCAG
JMFS150E02+ GAAGTGGGAAAGCGGCGTCAACTAATTCCATCTTGACTCCATTCAACGCCTCTGCAGCAG
                      ____________________________________________________________
consensus GAAGTGGGAAAGCGGCGTCAACTAATTCCATCTTGACTCCATTCAACGCCTCTGCAGCAG
 
. : . : . : . : . : . :
JMFN012K03+ GTGGAATATCCAACATGTGGAGAATTACAGGTTGGTCAGCACCCAACATCACACCCCGAG
JMFN003F01+ GTGGAATATCCAACATGTGGAGAATTACAGGTTGGTCAGCACCCAA-ATCACACCCCGAG
JMFF008O04+ GTGGAATATCCAACATGTGGAGAATTACAGGTTGGTCAGCACCCAACATCACACCCCGAG
JMFF028N20+ GTGGAATATCCAACATGTGGAGAATTACAGGTTGGTCAGCACCCAACATCACACCCCGAG
JMFF046P12+ GTGGAATATCCAACATGTGGAGAATTACAGGTTGGTCAGCACCCAACATCACACCCCGAG
JMFF047O11+ GTGGAATATCCAACATGTGGAGAATTACAGGTTGGTCAGCACCCAACATCACACCCCGAG
JMFF006B18+ GTGGAATATCCAACATGTGGAGAATTACAGGTTGGTCAGCACCCAACATCACACCCCGAG
JMFN010C08+ GTGGAATATCCAACATGTGGAGAATTACAGGTTGGTCAGCACCCAACATCACACCCCGAG
JMFS062H04+ GTGGAATATCCAACATGTGGAGAATTACAGGTTGGTCAGCACCCAACATCACACCCCGAG
JMFF040P24+ GTGGAATATCCAACATGTGGAGAATTACAGGTTGGTCAGCACCCAACATCACACCCCGAG
JMFS150E02+ GTGGAATATCCAACATGTGGAGAATTACAGGTTGGTCAGCACCCAACATCACACCCCGAG
                      ____________________________________________________________
consensus GTGGAATATCCAACATGTGGAGAATTACAGGTTGGTCAGCACCCAACATCACACCCCGAG
 
. : . : . : . : . : . :
JMFN012K03+ CAATCATTGGAACAAGAGCATATCCAATTTGTCCTGCAGCGCCGGTGACAAGCACGCGAA
JMFN003F01+ CAATCATTGGAACAAGAGCATATCCAATTTGTCCTGCAGCGCCGGTGACAAGCACGCGAA
JMFF008O04+ CAATCATTGGAACAAGAGCATATCCAATTTGTCCTGCAGCGCCGGTGACAAGCACGCGAA
JMFF028N20+ CAATCATTGGAACAAGAGCATATCCAATTTGTCCTGCAGCGCCGGTGACAAGCACGCGAA
JMFF046P12+ CAATCATTGGAACAAGAGCATATCCAATTTGTCCTGCAGCGCCGGTGACAAGCACGCGAA
JMFF047O11+ CAATCATTGGAACAAGAGCATATCCAATTTGTCCTGCAGCGCCGGTGACAAGCACGCGAA
JMFF006B18+ CAATCATTGGAACAAGAGCATATCCAATTTGTCCTGCAGCGCCGGTGACAAGCACGCGAA
JMFN010C08+ CAATCATTGGAACAAGAGCATATCCAATTTGTCCTGCAGCGCCGGTGACAAGCACGCGAA
JMFS062H04+ CAATCATTGGAACAAGAGCATATCCAATTTGTCCTGCAGCGCCGGTGACAAGCACGCGAA
JMFF040P24+ CAATCATTGGAACAAGAGCATATCCAATTTGTCCTGCAGCGCCGGTGACAAGCACGCGAA
JMFS150E02+ CAATCATTGGAACAAGAGCATATCCAATTTGTCCTGCAGCGCCGGTGACAAGCACGCGAA
                      ____________________________________________________________
consensus CAATCATTGGAACAAGAGCATATCCAATTTGTCCTGCAGCGCCGGTGACAAGCACGCGAA
 
. : . : . : . : . : . :
JMFN012K03+ CTGGTTCTTTCGCCATGGCTGTGAGAGGTCAGAGTCTA
JMFN003F01+ CTGGTTCTTTCGCCATGGCTGTGAGAGGTCAGAGTCTACTGAATCAGAGAGGATGAAGAA
JMFF008O04+ CTGGTTCTTTCGCCATGGCTGTGAGAGGTCAGAGTCTACTGAATCAGAGAGGATGAAGAA
JMFF028N20+ CTGGTTCTTTCGCCATGGCTGTGAGAGGTCAGAGTCTACTGAATCAGAGAGGATGAAGAA
JMFF046P12+ CTGGTTCTTTCGCCATGGCTGTGAGAGGTCAGAGTCTACTGAATCAGAGAGGATGAAGAA
JMFF047O11+ CTGGTTCTTTCGCCATGGCTGTGAGAGGTCAGAGTCTACTGAATCAGAGAGGATGAAGAA
JMFF006B18+ CTGGTTCTTTCGCCATGGCTGTGAGAGGTCAGAGTCTACTGAATCAGAGAGGATGAAGAA
JMFN010C08+ CTGGTTCTTTCGCCATGGCTGTGAGAGGTCAGAGTCTACTGAATCAGAGAGGATGAAGAA
JMFS062H04+ CTGGTTCTTTCGCCATGGCTGTGAGAGGTCAGAGTCTACTGAATCAGAGAGGATGAAGAA
JMFF040P24+ CTGGTTCTTTCGCCATGGCTGTGAGAGGTCAGAGTCTACTGAATCAGAGAGGATGAAGAA
JMFS150E02+ CTGGTTCTTTCGCCATGGCTGTGAGAGGTCAGAGTCTACTGAATCAGAGAGGATGAAGAA
                      ____________________________________________________________
consensus CTGGTTCTTTCGCCATGGCTGTGAGAGGTCAGAGTCTACTGAATCAGAGAGGATGAAGAA
 
. : . : . : . : . : . :
JMFN003F01+ GACGATCGA
JMFF008O04+ GACGATCGAGAGTAGCTTCTGGAG
JMFF028N20+ GACGATCGAGAGTAGCTTCTGGAGTG
JMFF046P12+ GACGATCGAGAGTAGCTTCTGGAGT
JMFF047O11+ GACGATCGAGAGTAGC
JMFF006B18+ GACGATCGAGAGTAGCTTCTGGAGTGGGG
JMFN010C08+ GACGATCGAGAGTAGCTTCTGGAGTGGGGCGTGA
JMFS062H04+ GACGATCGAGAGTAGCTTCTGGAGTGGGGCGTGACTCGTGAGGAGTACGATGAT
JMFF040P24+ GACGATCGAGAGTAGCTTCTGGAGTGGGGCGTGACTCGTGAGGAGTACGATGAT
JMFS150E02+ GACGATCGAGAGTAGCTTCTGGAGTGGGGCGTGACTCGTGAGGAGTACGATGATGTATTA
                      ____________________________________________________________
consensus GACGATCGAGAGTAGCTTCTGGAGTGGGGCGTGACTCGTGAGGAGTACGATGATGTATTA