Previous Contig 004116:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN034F02Sequence571004116 (2)pir|G85092|G850923e-21hypothetical protein AT4g09150 [imported] - Arabidopsis thaliana>gb:ATCHRIV26_15
JMFS149G09Sequence515004116 (2)pir|G85092|G850924e-16hypothetical protein AT4g09150 [imported] - Arabidopsis thaliana>gb:ATCHRIV26_15

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN034F02- CTAC
                      ____________________________________________________________
consensus CTAC
 
. : . : . : . : . : . :
JMFN034F02- TCCAGACGCTTCTTAGTCTAAAAATGGTAGGCAGTCCAGCAGACATGGAAAGGGTGTCCC
                      ____________________________________________________________
consensus TCCAGACGCTTCTTAGTCTAAAAATGGTAGGCAGTCCAGCAGACATGGAAAGGGTGTCCC
 
. : . : . : . : . : . :
JMFN034F02- AAACCAGCGTCAAACGCCTCTCTGAACTGCTGGACTCTGCCAAAGATGCCGGTATTCAAG
JMFS149G09+ ACTGCTGGACTCTGCCAAAGATGCCGGTATTCAAG
                      ____________________________________________________________
consensus AAACCAGCGTCAAACGCCTCTCTGAACTGCTGGACTCTGCCAAAGATGCCGGTATTCAAG
 
. : . : . : . : . : . :
JMFN034F02- ACATCATCTCAACCCTGTCCGAAGTGCTGGAGCAGGACAACTGTGTGGACACGACAAAGC
JMFS149G09+ ACATCATCTCAACCCTGTCCGAAGTGCTGGAGCAGGACAACTGTGTGGACACGACAAAGC
                      ____________________________________________________________
consensus ACATCATCTCAACCCTGTCCGAAGTGCTGGAGCAGGACAACTGTGTGGACACGACAAAGC
 
. : . : . : . : . : . :
JMFN034F02- TTCTTCAATCTATGAAGAATATTTCAAGCAGGATGCTATCTAAGAGCCTGCAATCCGAGG
JMFS149G09+ TTCTTCAATCTATGAAGAATATTTCAAGCAGGATGCTATCTAAGAGCCTGCAATCCGAGG
                      ____________________________________________________________
consensus TTCTTCAATCTATGAAGAATATTTCAAGCAGGATGCTATCTAAGAGCCTGCAATCCGAGG
 
. : . : . : . : . : . :
JMFN034F02- ACCCTGTCTTCCTTCGAGTCTCCCGCGCCATATATATGGCTGGACGAGGAGCTGTACTCG
JMFS149G09+ ACCCTGTCTTCCTTCGAGTCTCCCGCGCCATATATATGGCTGGACGAGGAGCTGTACTCG
                      ____________________________________________________________
consensus ACCCTGTCTTCCTTCGAGTCTCCCGCGCCATATATATGGCTGGACGAGGAGCTGTACTCG
 
. : . : . : . : . : . :
JMFN034F02- GAGGCGCTGGGGAACAGGGAAAGCAATTGGCAGAAAATGCACTGCGTCAGGTAGGAGCAG
JMFS149G09+ GAGGCGCTGGGGAACAGGGAAAGCAATTGGCAGAAAATGCACTGCGTCAGGTAGGAGCAG
                      ____________________________________________________________
consensus GAGGCGCTGGGGAACAGGGAAAGCAATTGGCAGAAAATGCACTGCGTCAGGTAGGAGCAG
 
. : . : . : . : . : . :
JMFN034F02- CGGCTCTAGTTAACGAAATCATGGAAGAAGTAGCTACTGTATTACTGGTCGCAGCTTCCG
JMFS149G09+ CGGCTCTAGTTAACGAAATCATGGAAGAAGTAGCTACTGTATTACTGGTCGCAGCTTCCG
                      ____________________________________________________________
consensus CGGCTCTAGTTAACGAAATCATGGAAGAAGTAGCTACTGTATTACTGGTCGCAGCTTCCG
 
. : . : . : . : . : . :
JMFN034F02- TGACAGTCAATGTTCACGGTCCTTGGTACGAACGTCTGATAGGAGATATGTGAAGAAAAA
JMFS149G09+ TGACAGTCAATGTTCACGGTCCTTGGTACGAACGTCTGATAGGAGATATGTGAAGAAAAA
                      ____________________________________________________________
consensus TGACAGTCAATGTTCACGGTCCTTGGTACGAACGTCTGATAGGAGATATGTGAAGAAAAA
 
. : . : . : . : . : . :
JMFN034F02- TTAGCATTCATTTGTACATATGATAGTGTCTTCTAGAATAATTGGCATTGTATTTATTGT
JMFS149G09+ TTAGCATTCATTTGTACATATGATAGTGTCTTCTAGAATAATTGGCATTGTATTTATTGT
                      ____________________________________________________________
consensus TTAGCATTCATTTGTACATATGATAGTGTCTTCTAGAATAATTGGCATTGTATTTATTGT
 
. : . : . : . : . : . :
JMFN034F02- GCATAAATAATAAAAACACTACTGCGT
JMFS149G09+ GCATAAATAATAAAAACACTACTGCGTAAAAAAAAAAAAAAAAAACTCGAGACTAGTCTC
                      ____________________________________________________________
consensus GCATAAATAATAAAAACACTACTGCGTAAAAAAAAAAAAAAAAAACTCGAGACTAGTCTC