Previous Contig 004108:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001E01Sequence259004690 (7)gb:AY113061_15782211e-27Arabidopsis thaliana AT4g28060/T13J8_170 mRNA, complete cds.>gb:AF412096_1797349240004108 (2)pir|T04188|T041883e-14subtilisin-like proteinase homolog F7L13.110 - Arabidopsis thaliana>gb:ATCHRIV29
JMFS148F12Sequence621004108 (2)pir|T04188|T041882e-43subtilisin-like proteinase homolog F7L13.110 - Arabidopsis thaliana>gb:ATCHRIV29

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS148F12- CGGACGCCTTCGACTACGGCG
                      ____________________________________________________________
consensus CGGACGCCTTCGACTACGGCG
 
. : . : . : . : . : . :
JMFS148F12- GCGGCATCGTCAATCCCAACGCCGCCGACGATCCCGGCCTGGTTTACGACATGAGAGGAA
                      ____________________________________________________________
consensus GCGGCATCGTCAATCCCAACGCCGCCGACGATCCCGGCCTGGTTTACGACATGAGAGGAA
 
. : . : . : . : . : . :
JMFS148F12- TAGATTACGCACAATACCTCTGTGCACTCGGCTACAACAATTCACTCATCTACAAGACCA
                      ____________________________________________________________
consensus TAGATTACGCACAATACCTCTGTGCACTCGGCTACAACAATTCACTCATCTACAAGACCA
 
. : . : . : . : . : . :
JMFS148F12- TATCAGGAAACCGAAACCGCAGTGATACAGAAGAACACACAATCTGTCCCAAGACCAGAC
                      ____________________________________________________________
consensus TATCAGGAAACCGAAACCGCAGTGATACAGAAGAACACACAATCTGTCCCAAGACCAGAC
 
. : . : . : . : . : . :
JMFS148F12- CTTCAATGCTGGATCTCAACCTCCCTTCAATGGTGGTACCCGATCTCTTCAAACCAGTAA
                      ____________________________________________________________
consensus CTTCAATGCTGGATCTCAACCTCCCTTCAATGGTGGTACCCGATCTCTTCAAACCAGTAA
 
. : . : . : . : . : . :
rJMFF001E01+ TGAGGAGANCCGTGACGAACGTGGGNCCTGTGAATTCAGTTTACAAAGCCATNGTCA
JMFS148F12- CCCTGAGGAGAACCGTGACGAACGTGGGACCTGTGAATTCAGTTTACAAAGCCATCGTCA
                      ____________________________________________________________
consensus CCCTGAGGAGAACCGTGACGAACGTGGGACCTGTGAATTCAGTTTACAAAGCCATCGTCA
 
. : . : . : . : . : . :
rJMFF001E01+ AGTNTCCCNTGGGGGCCGTNGTCACCGTGAAGCNTAAGGTGNTGAGGTTTGATGGTAATA
JMFS148F12- AGTCTCCCGTGGGGGCCGTCGTCACCGTGAAGCCTAAGGTGTTGAGGTTTGATGGTAATA
                      ____________________________________________________________
consensus AGTCTCCCGTGGGGGCCGTCGTCACCGTGAAGCCTAAGGTGTTGAGGTTTGATGGTAATA
 
. : . : . : . : . : . :
rJMFF001E01+ GAAAGAAGAGAAGCTTCACAATGAGGGTTTCTGCAGACAAANTGNNGAACTCTGCATTCA
JMFS148F12- GAAAGAAGAGAAGCTTCACAATGAGGGTTTCTGCAGACAAACTGGTGAACTCTGCATTCA
                      ____________________________________________________________
consensus GAAAGAAGAGAAGCTTCACAATGAGGGTTTCTGCAGACAAACTGGTGAACTCTGCATTCA
 
. : . : . : . : . : . :
rJMFF001E01+ CATNTGGGAGCTTGACCTGGAGTGATGGAGTTCATAATGTTAGAACCCCNATTGCTGTCA
JMFS148F12- CATTTGGGAGCTTGACCTGGAGTGATGGAGTTCATAATGTTAGAACCCCAATTGCTGTCA
                      ____________________________________________________________
consensus CATTTGGGAGCTTGACCTGGAGTGATGGAGTTCATAATGTTAGAACCCCAATTGCTGTCA
 
. : . : . : . : . : . :
rJMFF001E01+ G
JMFS148F12- GGAAGATGATTGTTCCCCTTTACCTTTAATTGTAAAAATGGGGTACGCTGGGATTGTTCT
                      ____________________________________________________________
consensus GGAAGATGATTGTTCCCCTTTACCTTTAATTGTAAAAATGGGGTACGCTGGGATTGTTCT
 
. : . : . : . : . : . :
JMFS148F12- TCACACACACACACACACAAAAAAATAATCATGCATGTAAATAAAGGTGAGCCGTTTGGT
                      ____________________________________________________________
consensus TCACACACACACACACACAAAAAAATAATCATGCATGTAAATAAAGGTGAGCCGTTTGGT