Previous Contig 004103:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS148B02Sequence622004103 (2)gb:AF109243_17686616e-68Arabidopsis thaliana mismatch repair protein (MSH2) gene, complete cds.
JMFS160H09Sequence514004103 (2)gb:AF109243_17686611e-53Arabidopsis thaliana mismatch repair protein (MSH2) gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS148B02+ TAGTAAGATCAACATAACCTAA
                      ____________________________________________________________
consensus TAGTAAGATCAACATAACCTAA
 
. : . : . : . : . : . :
JMFS148B02+ CCCAACAACGCATCCATTTTCACGAATGTTTGGAACAAGAGCTACAATTACGGGAGAATC
                      ____________________________________________________________
consensus CCCAACAACGCATCCATTTTCACGAATGTTTGGAACAAGAGCTACAATTACGGGAGAATC
 
. : . : . : . : . : . :
JMFS160H09+ AATGTCCTCAAAACTTCCAAGATTCCCAGGGGTCCC
JMFS148B02+ TTGCATTTCATTATTTGCAAAAAGAATGTCCTCAAAACTTCCAAGATTCCCAGGGGTCCC
                      ____________________________________________________________
consensus TTGCATTTCATTATTTGCAAAAAGAATGTCCTCAAAACTTCCAAGATTCCCAGGGGTCCC
 
. : . : . : . : . : . :
JMFS160H09+ AGTTTTAACTAATCTCCAGTTTGAGCCACTACCCTCATACAACTCAAGAGTGTGATCAGT
JMFS148B02+ AGTTTTAACTAATCTCCAGTTTGAGCCACTACCCTCATACAACTCAAGAGTGTGATCAGT
                      ____________________________________________________________
consensus AGTTTTAACTAATCTCCAGTTTGAGCCACTACCCTCATACAACTCAAGAGTGTGATCAGT
 
. : . : . : . : . : . :
JMFS160H09+ CCTCTCCAGGAGAAGGTCACGGGCTATTGTCTCAAACATGTTTCTACTCATACTAACACT
JMFS148B02+ CCTCTCCAGGAGAAGGTCACGGGCTATTGTCTCAAACATGTTTCTACTCATACTAACACT
                      ____________________________________________________________
consensus CCTCTCCAGGAGAAGGTCACGGGCTATTGTCTCAAACATGTTTCTACTCATACTAACACT
 
. : . : . : . : . : . :
JMFS160H09+ AGAGATGGCACCAGGTCCACTACCCAACTGCCGTAAAGCAGTTGTAGTATGGTAATAAGT
JMFS148B02+ AGAGATGGCACCAGGTCCACTACCCAACTGCCGTAAAGCAGTTGTAGTATGGTAATAAGT
                      ____________________________________________________________
consensus AGAGATGGCACCAGGTCCACTACCCAACTGCCGTAAAGCAGTTGTAGTATGGTAATAAGT
 
. : . : . : . : . : . :
JMFS160H09+ CTTTGCTATGAAAGTTGCATTGTTCCCATGAGCTGTGTAATAATCTCGGCGATCGAAAAA
JMFS148B02+ CTTTGCTATGAAAGTTGCATTGTTCCCATGAGCTGTGTAATAATCTCGGCGATCGAAAAA
                      ____________________________________________________________
consensus CTTTGCTATGAAAGTTGCATTGTTCCCATGAGCTGTGTAATAATCTCGGCGATCGAAAAA
 
. : . : . : . : . : . :
JMFS160H09+ CCGAACAACCCTAGTGTCACTGGGTAGCGTTTTGAAGAATGAGAGAAACCCTTGAGCTTG
JMFS148B02+ CCGAACAACCCTAGTGTCACTGGGTAGCGTTTTGAAGAATGAGAGAAACCCTTGAGCTTG
                      ____________________________________________________________
consensus CCGAACAACCCTAGTGTCACTGGGTAGCGTTTTGAAGAATGAGAGAAACCCTTGAGCTTG
 
. : . : . : . : . : . :
JMFS160H09+ CTTGGCATCGAGTTTGAGCTCCGGAAGCTTGTTTTGTTCCTCAAATTTTTCATCCATTTT
JMFS148B02+ CTTGGCATCGAGTTTGAGCTCCGGAAGCTTGTTTTGTTCCTCAAATTTTTCATCCATTTT
                      ____________________________________________________________
consensus CTTGGCATCGAGTTTGAGCTCCGGAAGCTTGTTTTGTTCCTCAAATTTTTCATCCATTTT
 
. : . : . : . : . : . :
JMFS160H09+ TAAGGATTAAGAAGAAATTGCTCAATCGAAAATGAGGAATTGTTTAGAATAACACTCTCG
JMFS148B02+ TAAGGATTAAGAAGAAATTGCTCAATCGAAAATGAGGAATTGTTTAGAATAACACTCTCG
                      ____________________________________________________________
consensus TAAGGATTAAGAAGAAATTGCTCAATCGAAAATGAGGAATTGTTTAGAATAACACTCTCG
 
. : . : . : . : . : . :
JMFS160H09+ GCTCAGTGTCGGGCCACTATACTATATACCCCATGAATTCACGGCAATCGAAAACGGA
JMFS148B02+ GCTCAGTGTCGGGCCACTATACTATATACCCCATGAATTCACGGCAATCGAAAACGGAGG
                      ____________________________________________________________
consensus GCTCAGTGTCGGGCCACTATACTATATACCCCATGAATTCACGGCAATCGAAAACGGAGG