Previous Contig 004102:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS013H05Sequence559004102 (4)
JMFS125E04Sequence555004102 (4)
JMFS132A09Sequence626004102 (4)
JMFS148A04Sequence627004102 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS013H05+ CAGCAGGCCAATTACTTTAACCAATTCAAATTGAATN
JMFS132A09+ TCCAATAATCCAATTCAGGGACCAGCAGGCCAATTACTTTAACCAATTCAAATTGAATT
JMFS148A04+ ATTACTTTAACCAATTCAAATTGAATT
                      ____________________________________________________________
consensus TCCAATAATCCAATTCAGGGACCAGCAGGCCAATTACTTTAACCAATTCAAATTGAATT
 
. : . : . : . : . : . :
JMFS013H05+ TGTAA-TATTTCCAACAACCTACCCAACAGTCTCAGAGAAAGCTGCTACTTTTACCATAA
JMFS132A09+ TGTAATTATTTCCAACAACCTACCCAACAGTCTCAGAGAAAGCTGCTACTTTTACCATAA
JMFS125E04+ TGCTACTTTTACCATAA
JMFS148A04+ TGTAATTATTTCCAACAACCTACCCAACAGTCTCAGAGAAAGCTGCTACTTTTACCATAA
                      ____________________________________________________________
consensus TGTAATTATTTCCAACAACCTACCCAACAGTCTCAGAGAAAGCTGCTACTTTTACCATAA
 
. : . : . : . : . : . :
JMFS013H05+ ACTCCAAACCCAAAATTGGAAAACAAGTTAAAACAACGCAGTGGGCTACACGCACATGCA
JMFS132A09+ ACTCCAAACCCAAAATTGGAAAACAAGTTAAAACAACGCAGTGGGCTACACGCACATGCA
JMFS125E04+ ACTCCAAACCCAAAATTGGAAAACAAGTTAAAACAACGCAGTGGGCTACACGCACATGCA
JMFS148A04+ ACTCCAAACCCAAAATTGGAAAACAAGTTAAAACAACGCAGTGGGCTACACGCACATGCA
                      ____________________________________________________________
consensus ACTCCAAACCCAAAATTGGAAAACAAGTTAAAACAACGCAGTGGGCTACACGCACATGCA
 
. : . : . : . : . : . :
JMFS013H05+ TTGTATGTATGTGTGCGTGTATGTTATATACACGTATGTATATTTGTATGTATGCGTATA
JMFS132A09+ TTGTATGTATGTGTGCGTGTATGTTATATACACGTATGTATATTTGTATGTATGCGTATA
JMFS125E04+ TTGTATGTATGTGTGCGTGTATGTTATATACACGTATGTATATTTGTATGTATGCGTATA
JMFS148A04+ TTGTATGTATGTGTGCGTGTATGTTATATACACGTATGTATATTTGTATGTATGCGTATA
                      ____________________________________________________________
consensus TTGTATGTATGTGTGCGTGTATGTTATATACACGTATGTATATTTGTATGTATGCGTATA
 
. : . : . : . : . : . :
JMFS013H05+ ACTATTTGGTTTTTACTGCATACATAGCTGGCAGCCAGCCACTGGAATTTCTCTCGAGTG
JMFS132A09+ ACTATTTGGTTTTTACTGCATACATAGCTGGCAGCCAGCCACTGGAATTTCTCTCGAGTG
JMFS125E04+ ACTATTTGGTTTTTACTGCATACATAGCTGGCAGCCAGCCACTGGAATTTCTCTCGAGTG
JMFS148A04+ ACTATTTGGTTTTTACTGCATACATAGCTGGCAGCCAGCCACTGGAATTTCTCTCGAGTG
                      ____________________________________________________________
consensus ACTATTTGGTTTTTACTGCATACATAGCTGGCAGCCAGCCACTGGAATTTCTCTCGAGTG
 
. : . : . : . : . : . :
JMFS013H05+ GGGCCGAGCTTAGAACCCAAAACCACAGTCAATATCAGCCGCACAAATTTCCAAACCAAA
JMFS132A09+ GGGCCGAGCTTAGAACCCAAAACCACAGTCAATATCAGCCGCACAAATTTCCAAACCAAA
JMFS125E04+ GGGCCGAGCTTAGAACCCAAAACCACAGTCAATATCAGCCGCACAAATTTCCAAACCAAA
JMFS148A04+ GGGCCGAGCTTAGAACCCAAAACCACAGTCAATATCAGCCGCACAAATTTCCAAACCAAA
                      ____________________________________________________________
consensus GGGCCGAGCTTAGAACCCAAAACCACAGTCAATATCAGCCGCACAAATTTCCAAACCAAA
 
. : . : . : . : . : . :
JMFS013H05+ TTTGGAAAGCTTCAGCAACTTAGAATTAATGCATACAATTCAATCTCTGCATGTTTGTAA
JMFS132A09+ TTTGGAAAGCTTCAGCAACTTAGAATTAATGCATACAATTCAATCTCTGCATGTTTGTAA
JMFS125E04+ TTTGGAAAGCTTCAGCAACTTAGAATTAATGCATACAATTCAATCTCTGCATGTTTGTAA
JMFS148A04+ TTTGGAAAGCTTCAGCAACTTAGAATTAATGCATACAATTCAATCTCTGCATGTTTGTAA
                      ____________________________________________________________
consensus TTTGGAAAGCTTCAGCAACTTAGAATTAATGCATACAATTCAATCTCTGCATGTTTGTAA
 
. : . : . : . : . : . :
JMFS013H05+ AAATTTTGATAGCTCCAAAAGGTGAACGAAATCGATCTGAAATGAATAATACCCGTATCC
JMFS132A09+ AAATTTTGATAGCTCCAAAAGGTGAACGAAATCGATCTGAAATGAATAATACCCGTATCC
JMFS125E04+ AAATTTTGATAGCTCCAAAAGGTGAACGAAATCGATCTGAAATGAATAATACCCGTATCC
JMFS148A04+ AAATTTTGATAGCTCCAAAAGGTGAACGAAATCGATCTGAAATGAATAATACCCGTATCC
                      ____________________________________________________________
consensus AAATTTTGATAGCTCCAAAAGGTGAACGAAATCGATCTGAAATGAATAATACCCGTATCC
 
. : . : . : . : . : . :
JMFS013H05+ ACTCTACCCTGTTTCACCTAAAAATTCAAAGAACCTGAAGAGAGATAGCAAGACACAGTT
JMFS132A09+ ACTCTACCCTGTTTCACCTAAAAATTCAAAGAACCTGAAGAGAGATAGCAAGACACAGTT
JMFS125E04+ ACTCTACCCTGTTTCACCTAAAAATTCAAAGAACCTGAAGAGAGATAGCAAGACACAGTT
JMFS148A04+ ACTCTACCCTGTTTCACCTAAAAATTCAAAGAACCTGAAGAGAGATAGCAAGACACAGTT
                      ____________________________________________________________
consensus ACTCTACCCTGTTTCACCTAAAAATTCAAAGAACCTGAAGAGAGATAGCAAGACACAGTT
 
. : . : . : . : . : . :
JMFS013H05+ GCAGAAAAGAAAAAACTGCGAACGAGAGAGGT-AGAAGAGAAAC
JMFS132A09+ GCAGAAAAGAAAAAACTGCGAACGAGAGAGGTGAGAAGAGAAACATAGGTTCCTGCGTTT
JMFS125E04+ GCAGAAAAGAAAAAACTGCGAACGAGAGAGGTGAGAAGAGAAACATAGGTTCCTGCGTTT
JMFS148A04+ GCAGAAAAGAAAAAACTGCGAACGAGAGAGGTGAGAAGAGAAACATAGGTTCCTGCGTTT
                      ____________________________________________________________
consensus GCAGAAAAGAAAAAACTGCGAACGAGAGAGGTGAGAAGAGAAACATAGGTTCCTGCGTTT
 
. : . : . : . : . : . :
JMFS132A09+ CCCGGTGGTAGAATCATTCAGATCAAA
JMFS125E04+ CCCGGTGGTAGAATCATTCAGATCAAACCGACAGAAGGGGATGACTGAGGAGGAGAGA
JMFS148A04+ CCCGGTGGTAGAATCATTCAGATCAAACCGACAGAAGGGGATGACTGAGGAGGAGAGAGA
                      ____________________________________________________________
consensus CCCGGTGGTAGAATCATTCAGATCAAACCGACAGAAGGGGATGACTGAGGAGGAGAGAGA