Previous Contig 004094:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS053H11Sequence639004094 (10)gb:AY064960_15661381e-84Arabidopsis thaliana At2g13540/T10F5.8 mRNA, complete cds.>gb:BT000650_1634928 A
JMFS054F04Sequence608004094 (10)gb:AY064960_15661381e-82Arabidopsis thaliana At2g13540/T10F5.8 mRNA, complete cds.>gb:BT000650_1634928 A
JMFS059F08Sequence642004094 (10)gb:AY064960_15661383e-85Arabidopsis thaliana At2g13540/T10F5.8 mRNA, complete cds.>gb:BT000650_1634928 A
JMFS075B11Sequence616004094 (10)gb:AY064960_15661382e-84Arabidopsis thaliana At2g13540/T10F5.8 mRNA, complete cds.>gb:BT000650_1634928 A
JMFS117F12Sequence544004094 (10)gb:AY064960_15661381e-65Arabidopsis thaliana At2g13540/T10F5.8 mRNA, complete cds.>gb:BT000650_1634928 A
JMFS146H11Sequence633004094 (10)gb:AY064960_15661382e-66Arabidopsis thaliana At2g13540/T10F5.8 mRNA, complete cds.>gb:BT000650_1634928 A
JMFS157B05Sequence625004094 (10)gb:AY064960_15661384e-83Arabidopsis thaliana At2g13540/T10F5.8 mRNA, complete cds.>gb:BT000650_1634928 A
JMSF003O22Sequence280004094 (10)gb:AY064960_15661383e-27Arabidopsis thaliana At2g13540/T10F5.8 mRNA, complete cds.>gb:BT000650_1634928 A
JMSF023B05Sequence663004094 (10)gb:AY064960_15661381e-84Arabidopsis thaliana At2g13540/T10F5.8 mRNA, complete cds.>gb:BT000650_1634928 A
JMSF026E22Sequence556004094 (10)gb:AY064960_15661383e-72Arabidopsis thaliana At2g13540/T10F5.8 mRNA, complete cds.>gb:BT000650_1634928 A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS075B11+ GACCATTGTCAACATCATCAATAA
                      ____________________________________________________________
consensus GACCATTGTCAACATCATCAATAA
 
. : . : . : . : . : . :
JMFS075B11+ CCTCAAAGACAGAAAACCCTGAATCTGAAACATGCCTTCGGATACTTAAGTAGGCTTCAA
JMFS054F04+ ACTTAAGTAGGCTTCAA
JMFS059F08+ AACATGCCTTCGGATACTTAAGTAGGCTTCAA
JMFS053H11+ AACATGCCTTCGGATACTTAAGTAGGCTCNAA
JMFS157B05+ TAAGTAGGCTTCAA
JMSF023B05+ AACATGCCTTCGGATACTTAAGTAGGCTTCAA
                      ____________________________________________________________
consensus CCTCAAAGACAGAAAACCCTGAATCTGAAACATGCCTTCGGATACTTAAGTAGGCTTCAA
 
. : . : . : . : . : . :
JMFS075B11+ TGCCAACCATGACTCTTTCAATCTCCTCAGGAACTTGCTCAACAAGCTCAGCCCCACCCC
JMFS054F04+ TGCCAACCATGACTCTTTCAATCTCCTCAGGAACTTGCTCAACAAGCTCAGCCCCACCCC
JMFS059F08+ TGCCAACCATGACTCTTTCAATCTCCTCAGGAACTTGCTCAACAAGCTCAGCCCCACCCC
JMFS053H11+ TGCCAACCATGACTCTTTCAATCTCCTCAGGAACTTGCTCAACAAGCTCAGCCCCACCCC
JMSF026E22+ CACCCC
JMFS157B05+ TGCCAACCATGACTCTTTCAATCTCCTCAGGAACTTGCTCAACAAGCTCAGCCCCACCCC
JMSF023B05+ TGCCAACCATGACTCTTTCAATCTCCTCAGGAACTTGCTCAACAAGCTCAGCCCCACCCC
                      ____________________________________________________________
consensus TGCCAACCATGACTCTTTCAATCTCCTCAGGAACTTGCTCAACAAGCTCAGCCCCACCCC
 
. : . : . : . : . : . :
JMFS075B11+ ATGGAAGACATGATAAAATACAGGTTATATAAAAGTCAGCACGTGCTTGCCAAGCCGGAT
JMFS054F04+ ATGGAAGACATGATAAAATACAGGTTATATAAAAGTCAGCACGTGCTTGCCAAGCCGGAT
JMFS059F08+ ATGGAAGACATGATAAAATACAGGTTATATAAAAGTCAGCACGTGCTTGCCAAGCCGGAT
JMFS053H11+ ATGGAAGACATGATAAAATACAGGTTATATAAAAGTCAGCACGTGCTTGCCAAGCCGGAT
JMSF026E22+ ATGGAAGACATGATAAAATACAGGTTATATAAAAGTCAGCACGTGCTTGCCAAGCCGGAT
JMFS157B05+ ATGGAAGACATGATAAAATACAGGTTATATAAAAGTCAGCACGTGCTTGCCAAGCCGGAT
JMFS117F12+ ACAGGTTATAT-AAAGTCAGCACGTGCTTGCCAAGCCGGAT
JMSF023B05+ ATGGAAGACATGATAAAATACAGGTTATATAAAAGTCAGCACGTGCTTGCCAAGCCGGAT
JMFS146H11+ TATAAAAGTCAGCACGTGCTTGCCAAGCCGGAT
                      ____________________________________________________________
consensus ATGGAAGACATGATAAAATACAGGTTATATAAAAGTCAGCACGTGCTTGCCAAGCCGGAT
 
. : . : . : . : . : . :
JMFS075B11+ TTCCTTTCTCCTCATCCACTGTAGTTGCTGCTGATGACAATAATGTTTCAAAAACAACCA
JMFS054F04+ TTCCTTTCTCCTCATCCACTGTAGTTGCTGCTGATGACAATAATGTTTCAAAAACAACCA
JMFS059F08+ TTCCTTTCTCCTCATCCACTGTAGTTGCTGCTGATGACAATAATGTTTCAAAAACAACCA
JMFS053H11+ TTCCTTTCTCCTCATCCACTGTAGTTGCTGCTGATGACAATAATGTTTCAAAAACAACCA
JMSF026E22+ TTCCTTTCTCCTCATCCACTGTAGTTGCTGCTGATGACAATAATGTTTCAAAAACAACCA
JMFS157B05+ TTCCTTTCTCCTCATCCACTGTAGTTGCTGCTGATGACAATAATGTTTCAAAAACAACCA
JMFS117F12+ TTCCTTTCTCCTCATCCACTGTAGTTGCTGCTGATGACAATAATGTTTCAAAAACAACCA
JMSF023B05+ TTCCTTTCTCCTCATCCAGTGTAGTTGCTGCTGATGACAATAATGTTTCAAAAACAACCA
JMFS146H11+ TTCCTTTCTCCTCATCCACTGTAGTTGCTGCTGATGACAATAATGTTTCAAAAACAACCA
                      ____________________________________________________________
consensus TTCCTTTCTCCTCATCCACTGTAGTTGCTGCTGATGACAATAATGTTTCAAAAACAACCA
 
. : . : . : . : . : . :
JMFS075B11+ CTAAAGAACTTGATTGGATTACTTTGCTGCACATCAACACAGTCAGGAACCTCAACAAAA
JMFS054F04+ CTAAAGAACTTGATTGGATTACTTTGNTGCACATCAACACAGTCAGGAACCTCAACAAAA
JMFS059F08+ CTAAAGAACTTGATTGGATTACTTTGCTGCACATCAACACAGTCAGGAACCTCAACAAAA
JMFS053H11+ CTAAAGAACTTGATTGGATTACTTTGCTGCACATCAACACAGTCAGGAACCTCAACAAAA
JMSF026E22+ CTAAAGAACTTGATTGGATTACTTTGCTGCACATCAACACAGTCAGGAACCTCAACAAAA
JMFS157B05+ CTAAAGAACTTGATTGGATTACTTTGCTGCACATCAACACAGTCAGGAACCTCAACAAAA
JMFS117F12+ CTAAAGAACTTGATTGGATTACTTTGCTGCACATCAACACAGTCAGGAACCTCAACAAAA
JMSF023B05+ CTAAAGAACTTGATTGGATTACTTTGCTGCACATCAACACAGTCAGGAACCTCAACAAAA
JMFS146H11+ CTAAAGAACTTGATTGGATTACTTTGCTGCACATCAACACAGTCAGGAACCTCAACAAAA
                      ____________________________________________________________
consensus CTAAAGAACTTGATTGGATTACTTTGCTGCACATCAACACAGTCAGGAACCTCAACAAAA
 
. : . : . : . : . : . :
JMFS075B11+ TTCGGATTGAATTGCAATTTCCAGAATCCAAGGCATCCTGCAGGTTACTTTGAGTGCTCT
JMFS054F04+ TTCGGATTGAATTGCAATTTCCAGAATCCAAGGCATCCTGCAGGTTACTTTGAGTGCTCT
JMFS059F08+ TTCGGATTGAATTGCAATTTCCAGAATCCAAGGCATCCTGCAGGTTACTTTGAGTGCTCT
JMFS053H11+ TTCGGATTGAATTGCAATTTCCAGAATCCAAGGCATCCTGCAGGTTACTTTGAGTGCTCT
JMSF026E22+ TTCGGATTGAATTGCAATTTCCAGAATCCAAGGCATCCTGCAGGTTACTTTGAGTGCTCT
JMFS157B05+ TTCGGATTGAATTGCAATTTCCAGAATCCAAGGCATCCTGCAGGTTACTTTGAGTGCTCT
JMFS117F12+ TTCGGATTGAATTGCAATTTCCAGAATCCAAGGCATCCTGCAGGTTACTTTGAGTGCTCT
JMSF023B05+ TTCGGATTGAATTGCAATTTCCAGAATCCAAGGCATCCTGCAGGTTACTTTGAGTGCTCT
JMFS146H11+ TTCGGATTGAATTGCAATTTCCAGAATCCAAGGCATCCTGCAGGTTACTTTGAGTGCTCT
                      ____________________________________________________________
consensus TTCGGATTGAATTGCAATTTCCAGAATCCAAGGCATCCTGCAGGTTACTTTGAGTGCTCT
 
. : . : . : . : . : . :
JMFS075B11+ CCACTAATTTCCTGACAAATTCTTCATTCTCCAAATTCAGCAAACCAACCAAAGTTCCAT
JMFS054F04+ CCANTAATTTCCTGACAAATTCTTCATTCTCCAAATTCAGCAAACCAACCAAAGTTCCAT
JMFS059F08+ CCACTAATTTCCTGACAAATTCTTCATTCTCCAAATTCAGCAAACCAACCAAAGTTCCAT
JMFS053H11+ CCACTAATTTCCTGACAAATTCTTCATTCTCCAAATTCAGCAAACCAACCAAAGTTCCAT
JMSF026E22+ CCACTAATTTCCTGACAAATTCTTCATTCTCCAAATTCAGCAAACCAACCAAAGTTCCAT
JMFS157B05+ CCACTAATTTCCTGACAAATTCTTCATTCTCCAAATTCAGCAAACCAACCAAAGTTCCAT
JMSF003O22+ CCAAATTCAGCAAACCAACCAAAGTTCCAT
JMFS117F12+ CCACTAATTTCCTGACAAATTCTTCATTCTCCAAATTCAGCAAACCAACCAAAGTTCCAT
JMSF023B05+ CCACTAATTTCCTGACAAATTCTTCATTCTCCAAATTCAGCAAACCAACCAAAGTTCCAT
JMFS146H11+ CCACTAATTTCCTGACAAATTCTTCATTCTCCAAATTCAGCAAACCAACCAAAGTTCCAT
                      ____________________________________________________________
consensus CCACTAATTTCCTGACAAATTCTTCATTCTCCAAATTCAGCAAACCAACCAAAGTTCCAT
 
. : . : . : . : . : . :
JMFS075B11+ AGAGTGGAATCTTGTGAGGCAATTGCTCAGCACACTGGAGAAGAAACGGCAGAATATCAT
JMFS054F04+ AGAGTGGAATCTTGTGAGGCAATTGCTCAGCACACTGGAGAAGAAACGGCAGAATATCAT
JMFS059F08+ AGAGTGGAATCTTGTGAGGCAATTGCTCAGCACACTGGAGAAGAAACGGCAGAATATCAT
JMFS053H11+ AGAGTGGAATCTTGTGAGGCAATTGCTCAGCACACTGGAGAAGAAACGGCAGAATATCAT
JMSF026E22+ AGAGTGGAATCTTGTGAGGCAATTGCTCAGCACACTGGAGAAGAAACGGCAGAATATCAT
JMFS157B05+ AGAGTGGAATCTTGTGAGGCAATTGCTCAGCACACTGGAGAAGAAACGGCAGAATATCAT
JMSF003O22+ AGAGTGGAATCTTGTGAGGCAATTGCTCAGCACACTGGAGAAGAAACGGCAGAATATCAT
JMFS117F12+ AGAGTGGAATCTTGTGAGGCAATTGCTCAGCACACTGGAGAAGAAACGGCAGAATATCAT
JMSF023B05+ AGAGTGGAATCTTGTGAGGCAATTGCTCAGCACACTGGAGAAGAAACGGCAGAATATCAT
JMFS146H11+ AGAGTGGAATCTTGTGAGGCAATTGCTCAGCACACTGGAGAAGAAACGGCAGAATATCAT
                      ____________________________________________________________
consensus AGAGTGGAATCTTGTGAGGCAATTGCTCAGCACACTGGAGAAGAAACGGCAGAATATCAT
 
. : . : . : . : . : . :
JMFS075B11+ CCCCAGAATGCTCTAATTCTCGGCGAACCGAGCCGAAACATGTCTCAATTTGGTCTTTGA
JMFS054F04+ CCCCAGAATGCTCTAATTCTCGGCGAACCGAGCCGAAACATGTCTCAATTTGGTCTTTGA
JMFS059F08+ CCCCAGAATGCTCTAATTCTCGGCGAACCGAGCCGAAACATGTCTCAATTTGGTCTTTGA
JMFS053H11+ CCCCAGAATGCTCTAATTCTCGGCGAACCGAGCCGAAACATGTCTCAATTTGGTCTTTGA
JMSF026E22+ CCCCAGAATGCTCTAATTCTCGGCGAACCGAGCCGAAACATGTCTCAATTTGGTCTTTGA
JMFS157B05+ CCCCAGAATGCTCTAATTCTCGGCGAACCGAGCCGAAACATGTCTCAATTTGGTCTTTGA
JMSF003O22+ CCCCAGAATGCTCTAATTCTCGGCGAACCGAGCCGAAACATGTCTCAATTTGGTCTTTGA
JMFS117F12+ CCCCAGAATGCTCTAATTCTCGGCGAACCGAGCCGAAACATGTCTCAATTTGGTCTTTGA
JMSF023B05+ CCCCAGAATGCTCTAATTCTCGGCGAACCGAGCCGAAACATGTCTCAATTTGGTCTTTGA
JMFS146H11+ CCCCAGAATGCTCTAATTCTCGGCGAACCGAGCCGAAACATGTCTCAATTTGGTCTTTGA
                      ____________________________________________________________
consensus CCCCAGAATGCTCTAATTCTCGGCGAACCGAGCCGAAACATGTCTCAATTTGGTCTTTGA
 
. : . : . : . : . : . :
JMFS075B11+ AGTCTGGATTTCCGGCGTACTCCGGGCACTTGTCGCCGATCCGTAAGAGCAA
JMFS054F04+ AGTCTGGATTTCCGGCGTACTCCGGGCACTTGTCGCCGATCCGTAAGAGCAAGCTCCGCC
JMFS059F08+ AGTCTGGATTTCCGGCGTACTCCGGGCACTTGTCGCCGATCCGTAAGAGCAAGCTCCGCC
JMFS053H11+ AGTCTGGATTTCCGGCGTACTCCGGGCACTTGTCGCCGATCCGTAAGAGCAAGCTCCGCC
JMSF026E22+ AGTCTGGATTTCCGGCGTACTCCGGGCACTTGTCGCCGATCCGTAAGAGCAAGCTCCGCC
JMFS157B05+ AGTCTGGATTTCCGGCGTACTCCGGGCACTTGTCGCCGATCCGTAAGAGCAAGCTCCGCC
JMSF003O22+ AGTCTGGATTTCCGGCGTACTCCGGGCACTCGTCGCCGATCCGTAAGAGCAAGCTCCGCC
JMFS117F12+ AGTCTGGATTTCCGGCGTACTCCGGGCACTTGTCGCCGATCCGTAAGAGCAAGCTCCGCC
JMSF023B05+ AGTCTGGATTTCCGGCGTACTCCGGGCACTTGTCGCCGATCCGTAAGAGCAAGCTCCGCC
JMFS146H11+ AGTCTGGATTTCCGGCGTACTCCGGGCACTTGTCGCCGATCCGTAAGAGCAAGCTCCGCC
                      ____________________________________________________________
consensus AGTCTGGATTTCCGGCGTACTCCGGGCACTTGTCGCCGATCCGTAAGAGCAAGCTCCGCC
 
. : . : . : . : . : . :
JMFS054F04+ AACCGCTCATTCTAAACACTTCAAGAAGAAGAGAGAGACGGAACGGAGGGG
JMFS059F08+ AACCGCTCATTCTAAACACTTCAAGAAGAAGAGAGAGACGGAACGGAGGGGAGAACAGAG
JMFS053H11+ AACCGCTCATTCTAAACACTTCAAGAAGAAGAGAGAGACGGAACGGAGGGGAGAACAGAG
JMSF026E22+ AACCGCTCATTCTAAACACTTCAAGAAGAAGAGAGAGACGGAACGGAGGGGAGAACAGAG
JMFS157B05+ AACCGCTCATTCTAAACACTTCAAGAAGAAGAGAGAGACGGAACGGAGGGGAGAACAGAG
JMSF003O22+ AACCGCTCATTCTAAACACTTCAAGAAGAAGAGAGAGACGGAACGGAGGGGAGAACAGAG
JMFS117F12+ AACCGCTCATTCTAAACACTTCAAGAAGAAGAGAGAGACGGAACGGAGGGGAGAACAGAG
JMSF023B05+ AACCGCTCATTCTAAACACTTCAAGAAGAAGAGAGAGACGGAACGGAGGGGAGAACAGAG
JMFS146H11+ AACCGCTCATTCTAAACACTTCAAGAAGAAGAGAGAGACGGAACGGAGGGGAGAACAGAG
                      ____________________________________________________________
consensus AACCGCTCATTCTAAACACTTCAAGAAGAAGAGAGAGACGGAACGGAGGGGAGAACAGAG
 
. : . : . : . : . : . :
JMFS059F08+ TACAAAG
JMFS053H11+ TACAAAG
JMSF026E22+ TACAAAGGC
JMFS157B05+ TACAAAGGCGG
JMSF003O22+ TACAAAGGC
JMFS117F12+ TACAAAGGCGGGGAAGATTTTTGG
JMSF023B05+ TACAAAGGCGGGGAAGATTTTTGG
JMFS146H11+ TACAAAGGCGGGGAAGATTTTTGGGGACAAGGCCCAAGGGTTTTTTTATGCAAATTTTAT
                      ____________________________________________________________
consensus TACAAAGGCGGGGAAGATTTTTGGGGACAAGGCCCAAGGGTTTTTTTATGCAAATTTTAT
 
. : . : . : . : . : . :
JMFS146H11+ AATAGGAACCAGGATATAATTTCAAACCAATTGCGAGGTTTATAAATTATAGCTTGTTTC
                      ____________________________________________________________
consensus AATAGGAACCAGGATATAATTTCAAACCAATTGCGAGGTTTATAAATTATAGCTTGTTTC