Previous Contig 004090:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016O20Sequence605004090 (4)gb:AC145120_17442768e-72Solanum demissum chromosome 5 BAC PGEC446O19 genomic sequence, complete sequence
JMFF041F18Sequence654004090 (4)gb:AC145120_17442766e-71Solanum demissum chromosome 5 BAC PGEC446O19 genomic sequence, complete sequence602010126 (2)gb:AC145120_17442762e-19Solanum demissum chromosome 5 BAC PGEC446O19 genomic sequence, complete sequence
JMFS088E09Sequence361004090 (4)gb:AC145120_17442762e-41Solanum demissum chromosome 5 BAC PGEC446O19 genomic sequence, complete sequence
JMFS146C08Sequence641004090 (4)gb:AC145120_17442761e-62Solanum demissum chromosome 5 BAC PGEC446O19 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF016O20+ GGCATGAACTCGTACACCAAGAGCCGGTTGTCACCATCCG
JMFF041F18+ CTCGTACACCAAGAGCCGGTTGTCACCATCCG
                      ____________________________________________________________
consensus GGCATGAACTCGTACACCAAGAGCCGGTTGTCACCATCCG
 
. : . : . : . : . : . :
JMFF016O20+ AGGAGTATCCAATAAGTTTAACGAGGTTTGGATGATGAAGTTGCCCGAGATAATTAACTT
JMFF041F18+ AGGAGTATCCAATAAGTTTAACGAGGTTTGGATGATGAAGTTGCCCGAGATAATTAACTT
JMFS146C08+ AACGAGGTTTGGATGATGAAGTTGCCCGAGATAATTAACTT
                      ____________________________________________________________
consensus AGGAGTATCCAATAAGTTTAACGAGGTTTGGATGATGAAGTTGCCCGAGATAATTAACTT
 
. : . : . : . : . : . :
JMFF016O20+ CGGTCAGCCATTCTTTATGACCCTGAAAACCTTCCGGTTTCAACTTTTTCACCGCGATGA
JMFF041F18+ CGGTCAGCCATTCTTTATGACCCTGAAAACCTTCCGGTTTCAACTTTTTCACCGCGATGA
JMFS146C08+ CGGTCAGCCATTCTTTATGACCCTGAAAACCTTCCGGTTTCAACTTTTTCACCGCGATGA
                      ____________________________________________________________
consensus CGGTCAGCCATTCTTTATGACCCTGAAAACCTTCCGGTTTCAACTTTTTCACCGCGATGA
 
. : . : . : . : . : . :
JMFF016O20+ CCATCCCGAATCCGGGTCTTGTAGGGGTAAGAGAATGCTCGTCAATCCATCCTTTGAAAA
JMFS088E09+ ATCCGGGTCTTGTAGGGGTAAGAGAATGCTCGTCAATCCATCCTTTGAAAA
JMFF041F18+ CCATCCCGAATCCGGGTCTTGTAGGGGTAAGAGAATGCTCGTCAATCCATCCTTTGAAAA
JMFS146C08+ CCATCCCGAATCCGGGTCTTGTAGGGGTAAGAGAATGCTCGTCAATCCATCCTTTGAAAA
                      ____________________________________________________________
consensus CCATCCCGAATCCGGGTCTTGTAGGGGTAAGAGAATGCTCGTCAATCCATCCTTTGAAAA
 
. : . : . : . : . : . :
JMFF016O20+ CATAACCGAACCCTCCTTCCCCTAGAAGACTATCGGGTCTAAAGTTTCGGGTCGCACTCT
JMFS088E09+ CATAACCGAACCCTCCTTCCCCTAGAAGACTATCGGGTCTAAAGTTTCGGGTCGCACTCT
JMFF041F18+ CATAACCGAACCCTCCTTCCCCTAGAAGACTATCGGGTCTAAAGTTTCGGGTCGCACTCT
JMFS146C08+ CATAACCGAACCCTCCTTCCCCTAGAAGACTATCGGGTCTAAAGTTTCGGGTCGCACTCT
                      ____________________________________________________________
consensus CATAACCGAACCCTCCTTCCCCTAGAAGACTATCGGGTCTAAAGTTTCGGGTCGCACTCT
 
. : . : . : . : . : . :
JMFF016O20+ TGAGCTCGTGAAATGTGAAGGGTTTAACATTAGGGGACGGTAATATTTTGCCTTCAGATC
JMFS088E09+ TGAGCTCGTGAAATGTGAAGGGTTTAACATTAGGGGCCGGTAATATTTCGCCTTCAGATC
JMFF041F18+ TGAGCTCGTGAAATGTGAAGGGTTTAACATTAGGGGACGGTAATATTTCGCCTTCAGATC
JMFS146C08+ TGAGCTCGTGAAATGTGAAGGGTTTAACATTAGGGGACGGTAATATTTCGCCTTCAGATC
                      ____________________________________________________________
consensus TGAGCTCGTGAAATGTGAAGGGTTTAACATTAGGGGACGGTAATATTTCGCCTTCAGATC
 
. : . : . : . : . : . :
JMFF016O20+ GCGGTGTAGGAAAGCTGTCCACACTGCTTCTTCTACTATAAGACGGAATACTTAAGGTAG
JMFS088E09+ GCGGTGTAGGAAAGCTGTCCACACTGCTTCTTCTACTATAAGACGGAATACTTAAGGTAG
JMFF041F18+ GCGGTGTAGGAAAGCTGTCCACACTGCTTCTTCTACTATAAGACGGAATACTTAAGGTAG
JMFS146C08+ GCGGTGTAGGAAAGCTGTCCACACTGCTTCTTCTACTATAAGACGGAATACTTAAGGTAG
                      ____________________________________________________________
consensus GCGGTGTAGGAAAGCTGTCCACACTGCTTCTTCTACTATAAGACGGAATACTTAAGGTAG
 
. : . : . : . : . : . :
JMFF016O20+ AAGGAACAGAAAAGCTGCTCGCTTTGCTGGGAACTTTCGAGGCTTCAGAAGCAGAAGGGG
JMFS088E09+ AAGGAACAGAAAAGCTGCTCGCTTTGCTGGGAACTTTCGAGGCTTCAGAAGCAGAAGGGG
JMFF041F18+ AAGGAACAGAAAAGCTGCTCGCTTTGCTGGGAACTTTCGAGGCTTCAGAAGCAGAAGGGG
JMFS146C08+ AAGGAACAGAAAAGCTGCTCGCTTTGCTGGGAACTTTCGAGGCTTCAGAAGCAGAAGGGG
                      ____________________________________________________________
consensus AAGGAACAGAAAAGCTGCTCGCTTTGCTGGGAACTTTCGAGGCTTCAGAAGCAGAAGGGG
 
. : . : . : . : . : . :
JMFF016O20+ CGTGGGAGCTCAGAGTGGCATCAACTCTCGCTGAAGAACCAAAGCAATTACCCATCAAGA
JMFS088E09+ CGTGGGAGCTCAGAGTGGCATCAACTCTCGCTGAAGAACCAAAGCAATTACCCATCAA
JMFF041F18+ CGTGGGAGCTCAGAGTGGCATCAACTCTCGCTGAAGAACCAAAGCAATTACCCATCAAGA
JMFS146C08+ CGTGGGAGCTCAGAGTGGCATCAACTCTCGCTGAAGAACCAAAGCAATTACCCATCAAGA
                      ____________________________________________________________
consensus CGTGGGAGCTCAGAGTGGCATCAACTCTCGCTGAAGAACCAAAGCAATTACCCATCAAGA
 
. : . : . : . : . : . :
JMFF016O20+ TAAACCAAATCCACCAACAAAAATCAGGGCTTCAAGGAGAAAAATAATAATACTACTAAA
JMFF041F18+ TAAACCAAATCCACCAACAAAAATCAGGGCTTCAAGGAGAAAAATAATAATACTACTAAA
JMFS146C08+ TAAACCAAATCCACCAACAAAAATCAGGGCTTCAAGGAGAAAAATAATAATACTACTAAA
                      ____________________________________________________________
consensus TAAACCAAATCCACCAACAAAAATCAGGGCTTCAAGGAGAAAAATAATAATACTACTAAA
 
. : . : . : . : . : . :
JMFF016O20+ GATTGCAAGGAATCAAGGATCTTGC
JMFF041F18+ GATTGCAAGGAATCAAGGATCTTGCTGGGGAAACGCCTGAAACTAGAGAATATAAGCATA
JMFS146C08+ GATTGCAAGGAATCAAGGATCTTGCTGGGGAAACGCCTGAAACTAGAGAATATAAGCATA
                      ____________________________________________________________
consensus GATTGCAAGGAATCAAGGATCTTGCTGGGGAAACGCCTGAAACTAGAGAATATAAGCATA
 
. : . : . : . : . : . :
JMFF041F18+ TATACATAAATATCTAGGTGT
JMFS146C08+ TATACATAAATATCTAGGTGTGAAGATAAGGAAGGAGTACTAGTCAGCTAGCTAGATTTC
                      ____________________________________________________________
consensus TATACATAAATATCTAGGTGTGAAGATAAGGAAGGAGTACTAGTCAGCTAGCTAGATTTC