Previous Contig 004074:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001I17Sequence512004074 (328)pir|T07775|T077757e-37lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum487004074 (328)pir|T07775|T077751e-37lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF003I19Sequence726004074 (328)pir|T07775|T077752e-69lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF005J18Sequence160004074 (328)gb:AF361893_17914543e-13Gossypium hirsutum bacterial-induced lipoxygenase (Lox1) mRNA, complete cds.
JMFF006G02Sequence485004074 (328)pir|T07775|T077758e-35lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum717004074 (328)pir|T07775|T077759e-69lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF010G06Sequence541004074 (328)pir|T07775|T077759e-44lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum733004074 (328)pir|T07775|T077753e-83lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF016K21Sequence355004074 (328)pir|T06352|T063522e-08lipoxygenase (EC 1.13.11.12) - tomato>gb:LEU13681_1684702 Lycopersicon esculentu321004074 (328)pir|T06352|T063522e-08lipoxygenase (EC 1.13.11.12) - tomato>gb:LEU13681_1684702 Lycopersicon esculentu
JMFF019E16Sequence257004074 (328)gb:BX571857_7845660.041Staphylococcus aureus strain MSSA476, complete genome.198004074 (328)
JMFF019J03Sequence575004074 (328)pir|T07775|T077755e-48lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum687004074 (328)pir|T07775|T077753e-64lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF024G20Sequence525004074 (328)pir|T07775|T077751e-40lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum688004074 (328)pir|T07775|T077753e-64lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF027G23Sequence485004074 (328)pir|T07775|T077757e-36lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum223004074 (328)gb:BX571857_7845660.041Staphylococcus aureus strain MSSA476, complete genome.
JMFF027N22Sequence569004074 (328)pir|T07775|T077757e-48lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum759004074 (328)pir|T07775|T07775e-107lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF028K21Sequence594004074 (328)pir|T07775|T077752e-48lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum679004074 (328)pir|T07775|T077756e-63lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF029K04Sequence269004074 (328)gb:LECEVI34G_16842670.041L.esculentum mRNA for lipoxygenase.
JMFF030M16Sequence166004074 (328)685004074 (328)pir|T07775|T077758e-64lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF031B11Sequence589004074 (328)pir|T07775|T077752e-48lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum688004074 (328)pir|T07775|T077757e-63lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF031L07Sequence528004074 (328)pir|T07775|T077751e-39lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF032A12Sequence571004074 (328)pir|T07775|T077757e-48lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum739004074 (328)pir|T07775|T077753e-83lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF032C18Sequence567004074 (328)pir|T07775|T077752e-46lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum677004074 (328)pir|T07775|T077751e-68lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF032G23Sequence403004074 (328)pir|T07775|T077752e-25lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum759004074 (328)pir|T07775|T07775e-107lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF034B01Sequence578004074 (328)pir|T07775|T077751e-48lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF034K09Sequence586004074 (328)pir|S57964|S579644e-84lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro645004074 (328)pir|T07775|T077756e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF036E19Sequence489004074 (328)pir|S57964|S579647e-60lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro739009899 (3)pir|T07775|T077754e-88lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF038C11Sequence572004074 (328)pir|T07775|T077755e-48lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum784004074 (328)pir|T07775|T077752e-87lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF041O21Sequence640004074 (328)pir|T07775|T077751e-58lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum236004074 (328)
JMFF044A01Sequence640004074 (328)pir|T07775|T077759e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum570004074 (328)pir|T07775|T077755e-40lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF045C05Sequence623004074 (328)pir|T07775|T077752e-54lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum605004074 (328)pir|T07775|T077755e-60lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFF047A06Sequence388004074 (328)pir|T07775|T077753e-24lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum344004074 (328)pir|T06352|T063529e-08lipoxygenase (EC 1.13.11.12) - tomato>gb:LEU13681_1684702 Lycopersicon esculentu
JMFF047D06Sequence565004074 (328)pir|T07775|T077753e-47lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum235004074 (328)
JMFF048O04Sequence450004074 (328)pir|T07775|T077754e-32lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum290004074 (328)gb:BX571857_7845660.041Staphylococcus aureus strain MSSA476, complete genome.
JMFN003G19Sequence582004074 (328)pir|T07775|T077758e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFN004A07Sequence572004074 (328)pir|T07775|T077755e-40lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFN012A08Sequence503004074 (328)pir|T07775|T077756e-31lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFN018E20Sequence606004074 (328)pir|T07775|T077753e-89lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFN028G23Sequence607004074 (328)pir|T07775|T077758e-46lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFN029G13Sequence599004074 (328)pir|T07775|T077754e-85lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFN029P23Sequence427004074 (328)pir|T07775|T077752e-32lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFN032B22Sequence503004074 (328)pir|T07775|T077756e-31lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFN033O03Sequence632004074 (328)gb:AF019613_17615954e-70Solanum tuberosum lipoxygenase (plox1) mRNA, complete cds.
JMFN033P13Sequence185004074 (328)gb:AF019613_17615953e-20Solanum tuberosum lipoxygenase (plox1) mRNA, complete cds.
JMFN034I07Sequence613004074 (328)pir|T07775|T077751e-90lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFN036I16Sequence626004074 (328)pir|T07775|T077759e-90lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFN041O16Sequence599004074 (328)pir|T07775|T077755e-87lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFN043G08Sequence593004074 (328)pir|T07775|T077754e-86lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFN044D17Sequence545004074 (328)pir|T07775|T077752e-54lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFN044J17Sequence449004074 (328)pir|T07775|T077756e-14lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS001A09Sequence570004074 (328)pir|T07775|T077753e-49lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS001H09Sequence619004074 (328)pir|T07775|T077751e-17lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS001H10Sequence385004074 (328)pir|S57964|S579642e-14lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS002A08Sequence540004074 (328)pir|T07775|T077751e-56lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS002C12Sequence566004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS002D08Sequence444004074 (328)pir|T07775|T077759e-53lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS003A01Sequence567004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS003B02Sequence575004074 (328)pir|T07775|T077754e-53lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS004B09Sequence465004074 (328)gb:PDU418043_16996135e-33Prunus dulcis mRNA for lipoxygenase (lox gene).
JMFS004C03Sequence119004074 (328)
JMFS004G04Sequence457004074 (328)pir|T07775|T077756e-38lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS004H03Sequence487004074 (328)pir|T07775|T077752e-38lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS005E08Sequence565004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS005G03Sequence554004074 (328)pir|T07775|T077752e-49lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS006F05Sequence550004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS007D10Sequence627004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS008B06Sequence398004074 (328)pir|T07775|T077751e-17lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS008E10Sequence617004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS011H02Sequence498004074 (328)pir|T07775|T077754e-49lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS012A06Sequence611004074 (328)pir|T07775|T077758e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS016F03Sequence577004074 (328)pir|T07775|T077759e-54lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS017E04Sequence616004074 (328)gb:PDU418043_16996133e-51Prunus dulcis mRNA for lipoxygenase (lox gene).
JMFS018C08Sequence572004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS018D04Sequence623004074 (328)pir|T07775|T077754e-60lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS019A05Sequence553004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS019A09Sequence564004074 (328)pir|T07775|T077754e-49lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS019C04Sequence522004074 (328)pir|T07775|T077751e-49lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS019F09Sequence524004074 (328)pir|T07775|T077755e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS020A12Sequence627004074 (328)pir|T07775|T077752e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS022E09Sequence615004074 (328)pir|T07775|T077757e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS022E10Sequence610004074 (328)pir|T07775|T077753e-56lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS023C10Sequence564004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS023D10Sequence543004074 (328)pir|T07775|T077753e-46lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS023F10Sequence550004074 (328)pir|T07775|T077751e-49lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS025B06Sequence619004074 (328)pir|T07775|T077758e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS026D10Sequence475004074 (328)pir|T07775|T077752e-19lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS026D11Sequence629004074 (328)pir|T07775|T077752e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS026E02Sequence635004074 (328)pir|T07775|T077751e-62lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS026H02Sequence338004074 (328)pir|T07775|T077752e-21lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS027B05Sequence565004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS028B02Sequence629004074 (328)pir|T07775|T077752e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS028H04Sequence628004074 (328)pir|T07775|T077752e-60lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS031B12Sequence533004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS032F06Sequence565004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS033B09Sequence638004074 (328)pir|T07775|T077753e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS033D08Sequence628004074 (328)pir|T07775|T077752e-60lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS034A07Sequence622004074 (328)pir|T07775|T077755e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS034D02Sequence631004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS035H03Sequence609004074 (328)pir|T07775|T077754e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS036G02Sequence319004074 (328)gb:AY254345_15930836e-15Nicotiana attenuata lipoxygenase (Lox1a) mRNA, complete cds.>gb:AY254347_1593085
JMFS037C08Sequence618004074 (328)pir|T07775|T077758e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS037D04Sequence609004074 (328)pir|T07775|T077753e-54lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS039F10Sequence540004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS040E10Sequence627004074 (328)pir|T07775|T077752e-58lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS041B01Sequence615004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS041G10Sequence627004074 (328)pir|T07775|T077754e-58lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS043D05Sequence494004074 (328)pir|T07775|T077754e-29lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS044F01Sequence603004074 (328)pir|T07775|T077752e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS045D07Sequence320004074 (328)pir|T07775|T077752e-32lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS045E01Sequence597004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS045E10Sequence417004074 (328)pir|T07775|T077756e-41lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS046F06Sequence609004074 (328)pir|T07775|T077753e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS048E08Sequence609004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS050B08Sequence620004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS050G05Sequence583004074 (328)pir|T07775|T077751e-60lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS051A10Sequence541004074 (328)pir|T07775|T077751e-53lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS051E02Sequence606004074 (328)pir|T07775|T077751e-55lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS052A12Sequence496004074 (328)pir|T07775|T077759e-37lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS054C02Sequence562004074 (328)pir|T07775|T077753e-49lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS054C11Sequence604004074 (328)pir|T07775|T077754e-58lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS055D12Sequence627004074 (328)pir|T07775|T077758e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS055G02Sequence625004074 (328)pir|T07775|T077752e-61lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS057F07Sequence627004074 (328)pir|T07775|T077753e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS059A12Sequence642004074 (328)pir|T07775|T077751e-62lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS059C12Sequence627004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS059G04Sequence627004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS061A10Sequence616004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS061F06Sequence589004074 (328)pir|T07775|T077752e-43lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS061G03Sequence623004074 (328)pir|T07775|T077759e-61lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS063A06Sequence627004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS063C05Sequence627004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS063D06Sequence160004074 (328)
JMFS063G06Sequence627004074 (328)pir|T07775|T077753e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS064B03Sequence613004074 (328)pir|T07775|T077753e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS064F10Sequence597004074 (328)pir|T07775|T077753e-45lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS065G07Sequence617004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS066A12Sequence642004074 (328)pir|T07775|T077751e-62lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS067A02Sequence612004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS067D12Sequence627004074 (328)pir|T07775|T077758e-62lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS070C10Sequence623004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS070G07Sequence615004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS071H12Sequence626004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS072G06Sequence627004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS073C08Sequence627004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS073G11Sequence592004074 (328)pir|T07775|T077757e-44lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS073H06Sequence627004074 (328)pir|T07775|T077756e-62lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS074B07Sequence627004074 (328)pir|T07775|T077753e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS074B10Sequence627004074 (328)pir|T07775|T077753e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS074F07Sequence627004074 (328)pir|T07775|T077753e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS074G06Sequence627004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS075A04Sequence627004074 (328)pir|T07775|T077752e-63lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS076A06Sequence622004074 (328)pir|T07775|T077752e-58lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS076D02Sequence636004074 (328)pir|T07775|T077752e-64lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS076E10Sequence230004074 (328)gb:AY254346_15930842e-09Nicotiana attenuata lipoxygenase (Lox1b) mRNA, complete cds.
JMFS076F02Sequence617004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS076F06Sequence627004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS077D01Sequence556004074 (328)gb:PDU418043_16996132e-62Prunus dulcis mRNA for lipoxygenase (lox gene).
JMFS077E05Sequence642004074 (328)pir|S57964|S579646e-94lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS077H01Sequence627004074 (328)pir|T07775|T077754e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS078H09Sequence627004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS079B03Sequence626004074 (328)pir|T07775|T077756e-62lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS079B06Sequence614004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS079E12Sequence639004074 (328)gb:CAV417975_16456196e-62Corylus avellana lox gene for lipoxygenase, exons 1-9.
JMFS080B07Sequence619004074 (328)pir|T07775|T077752e-61lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS080F04Sequence627004074 (328)pir|T07775|T077752e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS081F12Sequence627004074 (328)pir|T07775|T077756e-62lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS082F01Sequence627004074 (328)pir|T07775|T077753e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS084B10Sequence627004074 (328)pir|T07775|T077758e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS084E08Sequence627004074 (328)pir|T07775|T077753e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS085F07Sequence596004074 (328)pir|T07775|T077757e-54lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS085G10Sequence616004074 (328)pir|T07775|T077755e-61lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS086C05Sequence618004074 (328)pir|T07775|T077754e-60lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS086H10Sequence624004074 (328)pir|T07775|T077756e-62lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS087H11Sequence465004074 (328)gb:AY008278_15581962e-24Lycopersicon esculentum lipoxygenase mRNA, complete cds.
JMFS088C06Sequence631004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS090D03Sequence617004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS090D04Sequence623004074 (328)pir|T07775|T077756e-53lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS090D07Sequence642004074 (328)pir|T07775|T077751e-62lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS092F08Sequence631004074 (328)pir|S57964|S579643e-71lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS092H08Sequence623004074 (328)pir|T07775|T077758e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS094G02Sequence618004074 (328)pir|T07775|T077758e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS095E05Sequence627004074 (328)pir|T07775|T077752e-61lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS096E09Sequence627004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS096G04Sequence627004074 (328)pir|T07775|T077754e-58lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS097E09Sequence616004074 (328)pir|T07775|T077757e-60lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS098E03Sequence626004074 (328)pir|T07775|T077759e-61lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS099G02Sequence609004074 (328)pir|T07775|T077758e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS102C04Sequence608004074 (328)pir|T07775|T077752e-56lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS102C10Sequence627004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS102G08Sequence625004074 (328)pir|T07775|T077754e-61lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS104A04Sequence615004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS104D08Sequence637004074 (328)pir|T07775|T077758e-60lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS105H04Sequence611004074 (328)pir|T07775|T077752e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS106H05Sequence627004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS110D01Sequence620004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS110H11Sequence623004074 (328)pir|T07775|T077752e-64lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS111F02Sequence627004074 (328)pir|T07775|T077759e-55lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS112A12Sequence627004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS112C02Sequence627004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS112C09Sequence627004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS112D08Sequence627004074 (328)pir|T07775|T077758e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS112E10Sequence624004074 (328)pir|T07775|T077758e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS114G01Sequence627004074 (328)pir|T07775|T077756e-62lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS114H02Sequence529004074 (328)pir|T07775|T077758e-45lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS114H07Sequence561004074 (328)pir|T07775|T077754e-53lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS115C06Sequence616004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS116H12Sequence583004074 (328)pir|T07775|T077752e-52lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS118B02Sequence614004074 (328)pir|T07775|T077752e-61lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS119F03Sequence627004074 (328)pir|T07775|T077751e-62lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS120A07Sequence627004074 (328)pir|T07775|T077753e-90lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS120G10Sequence627004074 (328)pir|T07775|T077754e-58lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS120H03Sequence627004074 (328)pir|T07775|T077756e-62lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS121B01Sequence562004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS121C11Sequence577004074 (328)gb:PDU418043_16996131e-63Prunus dulcis mRNA for lipoxygenase (lox gene).
JMFS121E02Sequence565004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS121F06Sequence561004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS121G11Sequence572004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS122D05Sequence556004074 (328)pir|T07775|T077753e-49lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS122D10Sequence549004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS123B03Sequence575004074 (328)pir|T07775|T077754e-53lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS123E04Sequence575004074 (328)pir|T07775|T077751e-49lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS123G04Sequence565004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS123H09Sequence562004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS125H02Sequence550004074 (328)pir|T07775|T077753e-49lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS126E05Sequence624004074 (328)pir|T07775|T077755e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS126H05Sequence626004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS127A07Sequence619004074 (328)pir|T07775|T077758e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS127B04Sequence626004074 (328)pir|T07775|T077759e-61lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS127F10Sequence612004074 (328)pir|T07775|T077758e-54lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS128C07Sequence641004074 (328)pir|T07775|T077752e-61lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS128F03Sequence616004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS129A11Sequence627004074 (328)pir|T07775|T077753e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS129H05Sequence626004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS130B02Sequence624004074 (328)pir|T07775|T077752e-61lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS130B07Sequence626004074 (328)pir|T07775|T077754e-56lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS130F01Sequence615004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS130H10Sequence626004074 (328)gb:PDU418043_16996133e-61Prunus dulcis mRNA for lipoxygenase (lox gene).
JMFS132C07Sequence626004074 (328)pir|T07775|T077755e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS133C04Sequence622004074 (328)pir|T07775|T077758e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS134G11Sequence624004074 (328)pir|T07775|T077758e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS136A06Sequence597004074 (328)gb:CAV417975_16456194e-67Corylus avellana lox gene for lipoxygenase, exons 1-9.
JMFS137C07Sequence592004074 (328)pir|T07775|T077755e-53lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS137D05Sequence626004074 (328)pir|T07775|T077752e-61lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS137H05Sequence594004074 (328)pir|T07775|T077753e-56lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS138D08Sequence622004074 (328)pir|T07775|T077758e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS138E06Sequence626004074 (328)pir|T07775|T077758e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS139B11Sequence626004074 (328)pir|T07775|T077755e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS139E12Sequence639004074 (328)pir|T07775|T077752e-64lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS140F07Sequence626004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS140G06Sequence626004074 (328)pir|T07775|T077758e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS140H06Sequence622004074 (328)pir|T07775|T077755e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS140H11Sequence626004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS141A12Sequence616004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS141D12Sequence626004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS142B06Sequence616004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS143D04Sequence620004074 (328)pir|T07775|T077751e-56lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS144B12Sequence626004074 (328)pir|T07775|T077753e-56lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS144C03Sequence626004074 (328)
JMFS144H07Sequence626004074 (328)pir|T07775|T077754e-58lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS145B09Sequence625004074 (328)pir|T07775|T077752e-61lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS145C03Sequence639004074 (328)pir|T07775|T077756e-63lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS145E08Sequence617004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS147C01Sequence627004074 (328)pir|T07775|T077755e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS147C11Sequence627004074 (328)pir|T07775|T077751e-54lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS147E01Sequence619004074 (328)pir|S57964|S579642e-81lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS147H02Sequence627004074 (328)pir|T07775|T077756e-62lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS147H07Sequence503004074 (328)gb:PDU418043_16996131e-35Prunus dulcis mRNA for lipoxygenase (lox gene).
JMFS148F07Sequence534004074 (328)pir|T07775|T077751e-44lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS150A10Sequence543004074 (328)pir|T07775|T077756e-48lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS150G03Sequence501004074 (328)pir|T07775|T077757e-32lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS150H11Sequence626004074 (328)pir|T07775|T077751e-62lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS151A02Sequence626004074 (328)pir|T07775|T077757e-60lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS151C11Sequence618004074 (328)pir|T07775|T077754e-66lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS151F12Sequence627004074 (328)pir|T07775|T077753e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS151H12Sequence614004074 (328)pir|T07775|T077751e-66lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS152A03Sequence624004074 (328)pir|T07775|T077756e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS152A10Sequence614004074 (328)pir|T07775|T077758e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS152C08Sequence626004074 (328)pir|T07775|T077757e-60lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS152G04Sequence565004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS152G07Sequence618004074 (328)pir|T07775|T077756e-62lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS153E02Sequence616004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS154C12Sequence577004074 (328)pir|T07775|T077751e-41lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS155A12Sequence641004074 (328)pir|S57964|S579649e-88lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS155F07Sequence622004074 (328)pir|T07775|T077757e-60lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS156C06Sequence635004074 (328)pir|T07775|T077751e-62lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS156C11Sequence624004074 (328)pir|T07775|T077758e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS156G04Sequence622004074 (328)pir|T07775|T077753e-57lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS157B11Sequence572004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS158D10Sequence420004074 (328)pir|T07775|T077752e-30lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS158F07Sequence271004074 (328)pir|S57964|S579644e-08lipoxygenase (EC 1.13.11.12) - common tobacco>gb:AX644612_1471506 Sequence 2 fro
JMFS159C08Sequence395004074 (328)pir|T07775|T077755e-42lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS159D09Sequence445004074 (328)pir|T07775|T077757e-32lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS159E12Sequence529004074 (328)pir|T07775|T077755e-45lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS161F04Sequence550004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS161F05Sequence553004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS161H10Sequence585004074 (328)pir|T07775|T077757e-54lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS162F03Sequence566004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS162G07Sequence550004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS163C02Sequence609004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS165G08Sequence540004074 (328)pir|T07775|T077754e-50lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS166E03Sequence441004074 (328)pir|T07775|T077755e-38lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS167A04Sequence622004074 (328)pir|T07775|T077755e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS167A10Sequence615004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS167B03Sequence616004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS167B05Sequence615004074 (328)pir|T07775|T077751e-59lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMFS168F10Sequence612004074 (328)pir|T07775|T077758e-54lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMSF033H21Sequence660004074 (328)pir|T07775|T077753e-74lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum663004074 (328)pir|T07775|T077752e-63lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum
JMSF037O22Sequence587004074 (328)pir|T07775|T077751e-49lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum651004074 (328)pir|T07775|T077754e-61lipoxygenase (EC 1.13.11.12) LX-3 - potato>gb:STU60202_1723138 Solanum tuberosum

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN044J17+ GATATAGCAATATATGTCTATAATTATTGGGACAAGAXXXXXXXXXXXXX
                      ____________________________________________________________
consensus GATATAGCAATATATGTCTATAATTATTGGGACAAGANNNNNNNNNNNNN
 
. : . : . : . : . : . :
rJMFF047A06- GAAAATCAAAGAAGCATTTATTAAATTATTATACAATACATGAAGGAATAGA
rJMFF016K21- ATTATTATACAATACATGAAGGAATAGA
rJMFF048O04- GAAAATCAAAGAAGCATTTATTAAATTATTATACAATACATGAAGGAATAGA
rJMFF029K04- AGGAATAGA
rJMFF041O21- GAAAATCAAAGAAGCATTTATTAAATTATTATACAATACATGAAGGAATAGA
rJMFF027G23- TTATTAAATTATTATACAATACATGAAGGAATAGA
rJMFF019E16- AATAGA
JMFF016K21+ GAAAATCAAAGAAGCATTTATTAAATTATTATACAATACATGAAGGAATAGA
JMFF019E16+ GAAAATCAAAGAAGCATTTATTAAATTATTATACAATACATGAAGGAATAGA
rJMFF047D06- GAAAACCAAAGAAGCATTTATTAAATTATTATACAATACCTGAAGGAATAGA
JMFN044J17+ XXXXXXXXGAAAATCAAAGAAGCATTTATTAAATTATTATACAATACATGAAGGAATAGA
JMFS073G11+ GAAAATCAAAGAAGCATTTATTAAATTATTATACAATACATGAAGGAATAGA
JMFS154C12+ ATCAAAGAAGCATTTATTAAATTATTATACAATACATGAAGGAATAGA
JMFS061F06+ AATCAAAGAAGCATTTATTAAATTATTATACAATACATGAAGGAATAGA
JMFS064F10+ GAAAATCAAAGAAGCATTTATTAAATTATTATACAATACATGAAGGAATAGA
rJMFF044A01- GAAAATCAAAGAAGCATTTATTAAATTATTATACAATACATGAAGGGATAGA
JMFS087H11+ GAAAATCAAAGAAGCATTTATTAAATTATTATACAATACATGAAGGAATAGA
JMFS008B06+ ATTAAATTATTATACAATACATGAAGGAATAGA
JMFN004A07+ GAAAATCAAAGAAGCATTTATTAAATTATTATACAATACATGAAGGAATAGA
JMFN012A08+ GAAAATCAAAGAAGCATTTATTAAATTATTATACAATACATGAAGGAATAGA
JMFN032B22+ GAAAATCAAAGAAGCATTTATTAAATTATTATACAATACATGAAGGAATAGA
JMFS043D05- GAAAATCAAAGAAGCATTTATTAAATTATTATACAATACATGAAGGAATAGA
JMFN028G23+ GAAAATCAAAGAAGCATTTATTAATNTATTATACAATACATGAAGGAATAGA
rJMFF006G02- T-TATTATACAATACATGAAGGAATAGA
rJMFF024G20- AT-TATTATACAATACATGAAGGAATAGA
rJMFF019J03- T-TATTATACAATACATGAAGGAATAGA
rJMFF030M16- AAT-TATTATACAATACATGAAGGAATAGA
rJMFF031B11- T-TATTATACAATACATGAAGGAATAGA
rJMFF028K21- T-TATTATACAATACATGAAGGAATAGA
rJMSF033H21- AGGAATAGA
rJMSF037O22- GGAATAGA
JMFF001I17+ TAGA
rJMFF003I19- AAT-TATTATACAATACATGAAGGAATAGA
                      ____________________________________________________________
consensus NNNNNNNNGAAAATCAAAGAAGCATTTATTAAATTATTATACAATACATGAAGGAATAGA
 
. : . : . : . : . : . :
rJMFF047A06- AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF016K21- AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF048O04- AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF029K04- AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF041O21- AAACAACCAACAATGG-GAGAAGATTTATTTAAAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF027G23- AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF019E16- AAACAACCAACGATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
JMFF016K21+ AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
JMFF019E16+ AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF047D06- AAACAACCAACAATGG-GAAAAAATTTATTTAGAGGCTTCCCAACAAGTTGAATTTCCAG
JMFN044J17+ AAACAACCAACAATGG-GAGAAAATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
JMFS073G11+ AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
JMFS154C12+ AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
JMFS061F06+ AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
JMFS064F10+ AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF044A01- AAACAACCAACAATGGTGAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
JMFS087H11+ AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
JMFS008B06+ AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
JMFN004A07+ AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
JMFN012A08+ AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
JMFN032B22+ AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
JMFS043D05- AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
JMFN028G23+ AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF006G02- AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF024G20- AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF019J03- AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF030M16- AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF031B11- AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF028K21- AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF032C18- CCAACAATGG-GAGAAGATTTATTTANAGTCTTCCCAACAAGTTGAATTTCCAG
rJMSF033H21- AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMSF037O22- AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF034K09- CCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
JMFS102C04+ AATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF045C05- AGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF001I17- ATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
JMFN003G19+ CAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
JMFN044D17+ CCAG
JMFF001I17+ AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF003I19- AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
rJMFF032A12- G
                      ____________________________________________________________
consensus AAACAACCAACAATGG-GAGAAGATTTATTTAGAGTCTTCCCAACAAGTTGAATTTCCAG
 
. : . : . : . : . : . :
rJMFF047A06- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF016K21- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF048O04- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF029K04- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF041O21- CTCCAAGGGTCTCCAAACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF027G23- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF019E16- CTCCGAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFF016K21+ CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFF019E16+ CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF047D06- CTCCAAGGGTCTCCAAACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFN044J17+ CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFS073G11+ CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFS154C12+ CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFS061F06+ CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFS064F10+ CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF044A01- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFS087H11+ CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFS008B06+ CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFN004A07+ CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFN012A08+ CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFN032B22+ CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFS043D05- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFN028G23+ CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF006G02- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF024G20- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF019J03- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF030M16- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTCATTTAAAACT
rJMFF031B11- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF028K21- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF032C18- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMSF033H21- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMSF037O22- CTCCAAGGGTCTCCACACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF034K09- CTCCAAGGGTCTCCAGACACGGTCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFS102C04+ CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF045C05- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF001I17- CTCCAGGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFN003G19+ CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFN044D17+ CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFF001I17+ CTCCAGGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF003I19- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
JMFN033O03+ CGGGCCCAGTTGGAGTCTTTTGAATTTATTTATNTAAAACT
rJMFF010G06- AGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF032A12- CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
rJMFF038C11- AGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
                      ____________________________________________________________
consensus CTCCAAGGGTCTCCAGACACGGGCCCAGTTGGAGTCTTTTGAATTTATTTATTTAAAACT
 
. : . : . : . : . : . :
rJMFF047A06- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF016K21- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF048O04- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF029K04- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF041O21- TCTGGAAAACATGCACGCAAAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF027G23- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF019E16- TCTGGAAAACATGCACGCAGAAACCAACACNCATACNCATAAAGTTTATTGCNATGCAAA
JMFF016K21+ TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFF019E16+ TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF047D06- TCTGGAAAACATGCACGCAAAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFN044J17+ TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFS073G11+ TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFS154C12+ TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFS159C08+ CAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFS061F06+ TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFS064F10+ TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF044A01- CCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFS087H11+ TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFS008B06+ TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFN004A07+ TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFN012A08+ TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFN032B22+ TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFS043D05- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFN028G23+ TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF006G02- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF024G20- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF019J03- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF030M16- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF031B11- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF028K21- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF032C18- TCTCGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMSF033H21- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMSF037O22- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF034K09- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFS102C04+ TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF045C05- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF001I17- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFN003G19+ TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFN044D17+ TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFF001I17+ TNTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF003I19- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
JMFN033O03+ TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF010G06- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF032A12- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF038C11- TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
rJMFF032G23- AGTTTATTGCAATGCAAA
rJMFF027N22- AGTTTATTGCAATGCAAA
                      ____________________________________________________________
consensus TCTGGAAAACATGCACGCAGAAACCAACACACATACGCATAAAGTTTATTGCAATGCAAA
 
. : . : . : . : . : . :
rJMFF047A06- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF016K21- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF048O04- TACGAGATAAAGCCATAAGAGTTATATAGAGAAGCTGTTCGGAATTCCTTTCCCGG
rJMFF029K04- TACNAGATAAAGCCATAANAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF041O21- TACGA
rJMFF027G23- TACGAGATA
rJMFF019E16- TACNAGATAAAGC
JMFF016K21+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFF019E16+ TACGAGATAAAGC
rJMFF047D06- TACG
JMFN044J17+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFS073G11+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFS154C12+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFS159C08+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFS061F06+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFS064F10+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF044A01- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFS087H11+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFS008B06+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFN004A07+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFN012A08+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFN032B22+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFS043D05- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFN028G23+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF006G02- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF024G20- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF019J03- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF030M16- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF031B11- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF028K21- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF032C18- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMSF033H21- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMSF037O22- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF034K09- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFS102C04+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF045C05- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF001I17- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFN003G19+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFN044D17+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFF001I17+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF003I19- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
JMFS002D08+ GGAATTCCTTTCCCGGAGAG
JMFN033O03+ TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF010G06- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF032A12- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF038C11- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF032G23- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
rJMFF027N22- TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
                      ____________________________________________________________
consensus TACGAGATAAAGCCATAAGAATTATATAGAGATGCTGTTCGGAATTCCTTTCCCGGAGAG
 
. : . : . : . : . : . :
rJMFF047A06- TCCTTCTTCTCCGGTGGGGAAGAGCANAGTGTATGGGACATTGACGGGGCCAG
rJMFF016K21- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGT
rJMFF029K04- TCCTTCTTCTCCGGTGGGGAA
JMFF016K21+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGT
JMFN044J17+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFS073G11+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFS154C12+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFS159C08+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFS061F06+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFS064F10+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMFF044A01- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFS087H11+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFS008B06+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFN004A07+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFN012A08+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFN032B22+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFS043D05- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFN028G23+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMFF006G02- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMFF024G20- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMFF019J03- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMFF030M16- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMFF031B11- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMFF028K21- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMFF032C18- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMSF033H21- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMSF037O22- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMFF034K09- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFS102C04+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMFF045C05- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMFF001I17- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFN003G19+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFN044D17+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFF001I17+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMFF003I19- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFS002D08+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFN033O03+ TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMFF010G06- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMFF032A12- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMFF038C11- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFN036I16+ GGGCCAGTCCTGTT
rJMFF032G23- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
JMFN029G13+ GGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
rJMFF027N22- TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
                      ____________________________________________________________
consensus TCCTTCTTCTCCGGTGGGGAAGAGCAAAGTGTATGGGACATTGACGGGGCCAGTCCTGTT
 
. : . : . : . : . : . :
JMFN044J17+ CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCT
JMFS073G11+ CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFS154C12+ CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFS159C08+ CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFS061F06+ CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFS064F10+ CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMFF044A01- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFS087H11+ CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFS008B06+ CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFN004A07+ CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFN012A08+ CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFN032B22+ CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFS043D05- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFN028G23+ CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMFF006G02- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMFF024G20- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMFF019J03- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMFF030M16- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMFF031B11- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMFF028K21- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMFF032C18- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMSF033H21- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMSF037O22- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMFF034K09- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFS102C04+ CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMFF045C05- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMFF001I17- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFN003G19+ CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFN044D17+ CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFF001I17+ CTTCAATTTCCCATCNCCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGNTTCTT
rJMFF003I19- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFS002D08+ CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFN033O03+ CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMFF010G06- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMFF032A12- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMFF038C11- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFN036I16+ CTTCAATTTCCCATCACCATTCATCTNTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMFF032G23- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
JMFN029G13+ CTTCAATTTCCCATCACCATTCATCTNTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
rJMFF027N22- CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
                      ____________________________________________________________
consensus CTTCAATTTCCCATCACCATTCATCTTTAGTATGCGCTCTTCTATCGCAACCAGCTTCTT
 
. : . : . : . : . : . :
JMFS073G11+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFS154C12+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFS159C08+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFS061F06+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFS064F10+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMFF044A01- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFS087H11+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTG
JMFS008B06+ CCCAAA
JMFN004A07+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFN012A08+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFN032B22+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFS043D05- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFN028G23+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMFF006G02- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMFF024G20- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMFF019J03- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMFF030M16- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMFF031B11- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMFF028K21- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMFF032C18- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMSF033H21- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMSF037O22- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMFF034K09- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFS102C04+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMFF045C05- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMFF001I17- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFN003G19+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFN044D17+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFF001I17+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMFF003I19- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFS002D08+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFN033O03+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMFF010G06- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMFF032A12- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMFF038C11- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFN036I16+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMFF032G23- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFN029G13+ CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
rJMFF027N22- CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
JMFS120A07+ CAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
                      ____________________________________________________________
consensus CCCAAACCTCTCAAATGCCTCCAAAGCCTCCTTATCCTTGGTCCACTCAGGGTGCTCTCT
 
. : . : . : . : . : . :
JMFS073G11+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
JMFS154C12+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
JMFS159C08+ TTGCCCGAGGTAAATCTCATCGGAACCACGCCTGGACAGGATCTCAATCAGGGAAATTCC
JMFS061F06+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
JMFS064F10+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMFF044A01- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
JMFN004A07+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
JMFN012A08+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCC
JMFN032B22+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCC
JMFS043D05- TTGCCCGAGGTAAATCTCATCGG
JMFN028G23+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMFF006G02- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMFF024G20- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMFF019J03- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMFF030M16- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMFF031B11- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMFF028K21- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMFF032C18- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMSF033H21- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMSF037O22- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMFF034K09- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
JMFS102C04+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMFF045C05- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMFF001I17- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
JMFN003G19+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
JMFN044D17+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
JMFF001I17+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMFF003I19- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
JMFS002D08+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
JMFN033O03+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMFF010G06- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMFF032A12- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMFF038C11- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
JMFN036I16+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMFF032G23- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
JMFN029G13+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
rJMFF027N22- TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
JMFS120A07+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
JMFN034I07+ TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
                      ____________________________________________________________
consensus TTGCCCGAGGTAAATCTCATCGGAAGCATGCCTGGACAGGATCTCAATCAGGGAAATTCC
 
. : . : . : . : . : . :
JMFS073G11+ GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTT
JMFS154C12+ GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAG
JMFS159C08+ GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGCTAGTT
JMFS061F06+ GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGCTAGTT
JMFS064F10+ GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMFF044A01- CAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGA
JMFN004A07+ GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCG
JMFN028G23+ GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMFF006G02- GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMFF024G20- GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMFF019J03- GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMFF030M16- GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMFF031B11- GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMFF028K21- GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMFF032C18- GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMSF033H21- GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMSF037O22- GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMFF034K09- GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
JMFS102C04+ GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMFF045C05- GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMFF001I17- GAGCAAAGTCAGCGGCAAAG
JMFN003G19+ GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
JMFN044D17+ GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
JMFF001I17+ GAGCAAAGTCAGCGGCAAAG
rJMFF003I19- GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
JMFS002D08+ GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
JMFN033O03+ GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMFF010G06- GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMFF032A12- GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMFF038C11- GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
JMFN036I16+ GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMFF032G23- GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
JMFN033P13+ AGTTTT
JMFN029G13+ GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
rJMFF027N22- GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
JMFS120A07+ GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
JMFN034I07+ GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
                      ____________________________________________________________
consensus GAGCAAAGTCTGCGGCAAAGCAGTGATAGTTTTCAAGAGCGCCTTATCAGGGTTAGTTTT
 
. : . : . : . : . : . :
JMFS064F10+ CAGCTC
JMFN028G23+ CAGCTCCTCG
rJMFF006G02- CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
rJMFF024G20- CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
rJMFF019J03- CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
rJMFF030M16- CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
rJMFF031B11- CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
rJMFF028K21- CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
rJMFF032C18- CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
rJMSF033H21- CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
rJMSF037O22- CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
rJMFF034K09- CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
JMFS102C04+ CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
rJMFF045C05- CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
JMFN003G19+ CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGG-ATGAACTTTCGGC
JMFN044D17+ CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
rJMFF003I19- CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
JMFS002D08+ CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
JMFN033O03+ CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
rJMFF010G06- CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
rJMFF032A12- CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
rJMFF038C11- CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
JMFN036I16+ CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
rJMFF032G23- CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
JMFN033P13+ CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
JMFN029G13+ CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
rJMFF027N22- CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
JMFS120A07+ CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
JMFN034I07+ CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
JMFN043G08+ CGTTGGGCG
                      ____________________________________________________________
consensus CAGCTCCTCGTAGTCGGCACTCCCCGGCTCCGGCATGAACTTTCGGCTCACCGTTGGGCG
 
. : . : . : . : . : . :
rJMFF006G02- GCAGGGGTTGTAA-CCTGCGTANGCGTACTGCCCAAAATTGACGGCGGCGTGGANGGCGG
rJMFF024G20- GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
rJMFF019J03- GCAGGGGTTGTAA-CCTGCGTANGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
rJMFF030M16- GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGC
rJMFF031B11- GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGA
rJMFF028K21- GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGA
rJMFF032C18- GCAGGGGTTGTAA-CCTGCGTANGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
rJMSF033H21- GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGG
rJMSF037O22- GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGG
rJMFF034K09- GCAGGGGTTGTAACCCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTG
JMFS102C04+ GCAGGGGTTGTAA-CCTGCGT
rJMFF045C05- GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAA
JMFN044D17+ G
rJMFF003I19- GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
JMFS002D08+ GCAGGGG
JMFN033O03+ GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
rJMFF010G06- GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
rJMFF032A12- GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
rJMFF038C11- GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
JMFN036I16+ GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
rJMFF032G23- GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
JMFN033P13+ GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
rJMFF005J18- A-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
JMFN029G13+ GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
rJMFF027N22- GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
JMFS120A07+ GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
JMFN034I07+ GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
JMFN043G08+ GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
                      ____________________________________________________________
consensus GCAGGGGTTGTAA-CCTGCGTAGGCGTACTGCCCAAAATTGACGGCGGCGTGGAGGGCGG
 
. : . : . : . : . : . :
rJMFF006G02- AGGATATCCAGATGATGGTTGTGCAGGTGTCG
rJMFF024G20- AG
rJMFF019J03- AG
rJMFF032C18- AGGATATCCAGATGATGGTTGTGCA
rJMFF003I19- AGGATATCCAGATGATGGTTGTGCAGGTGTCGA
JMFN033O03+ AGGATATCCAGATGATGGTTGTGCAGGTGTCGATTAGAAGGTGGCGAGAGAC
rJMFF010G06- AGGATATCCAGATGATGGTTGTGCAGGTGTCGATTAGAAGGTGGCGAGAGACTATTCTGG
rJMFF032A12- AGGATATCCAGATGATGGTTGTGCAGGTGTCGATTANAAGGTGGCGAGAGACTATTCTGG
rJMFF038C11- AGGATATCCAGATGATGGTTGTGCAGGTGTCGATTAGANNGTGGCGAGAGACTATTCTGG
JMFN036I16+ AGGATATCCAGATGATGGTTGTGCAGGTGTCGATTAGAAGGTGGCGAGAGACTATTCTGG
rJMFF032G23- AGGATATCCAGATGATGGTTGTGCAGGTGTCGATTAGAAGGTGGCGAGAGACTATTCTGG
JMFN033P13+ AGGATATCCAGATGATGGTTGTGCAGGTGTCGATTAGAAGGTGGCGAGAGACTATTCTGG
rJMFF005J18- AGGATATCCANATGATGGTTGTGCAGGTGTCGATTANAAGGNGGCGAGAGACTATTCTGG
JMFN029G13+ AGGATATCCAGATGATGGTTGTGCAGGTGTCGATTAGAAGGTGGCGAGAGACTATTCTGG
rJMFF027N22- AGGATATCCAGATGATGGTTGTGCAGGTGTCGATTAGAAGGTGGCGAGAGACTATTCTGG
JMFS120A07+ AGGATATCCAGATGATGGTTGTGCAGGTGTCGATTAGAAGGTGGCGAGAGACTATTCTGG
JMFN034I07+ AGGATATCCAGATGATGGTTGTGCAGGTGTCGATTAGAAGGTGGCGAGAGACTATTCTGG
JMFN043G08+ AGGATATCCAGATGATGGTTGTGCAGGTGTCGATTAGAAGGTGGCGAGAGACTATTCTGG
                      ____________________________________________________________
consensus AGGATATCCAGATGATGGTTGTGCAGGTGTCGATTAGAAGGTGGCGAGAGACTATTCTGG
 
. : . : . : . : . : . :
rJMFF010G06- GCCACCATGGCTCGTCTTTCTTGTCTTCATGTCCCTTTTGAACAACCTCGGTCCACCAAG
rJMFF032A12- GCCACCATGGCTCGTCTTTCTTGTCTTCATGTCCCTTTTGAACAACCTCGGTCCACCAAG
rJMFF038C11- GCCACCATGGCTCGTCTTTCTTGTCTTCATGTCCCTTTTGAACAACCTCGGTCCACCAAG
JMFN036I16+ GCCACCATGGCTCGTCTTTCTTGTCTTCATGTCCCTTTTGAACAACCTCGGTCCACCAAG
rJMFF032G23- GCCACCATGGCTCGTCTTTCTTGTCTTCATGTCCCTTTTGAACAACCTCGGTCCACCAAG
rJMFF005J18- GCCACCATGGCTCGNCTTTCTTGTCTTCNTGTCCCTTTTGAACA
JMFN029G13+ GCCACCATGGCTCGTCTTTCTTGTCTTCATGTCCCTTTTGAACAACCTCGGTCCACCAAG
rJMFF027N22- GCCACCATGGCTCGTCTTTCTTGTCTTCATGTCCCTTTTGAACAACCTCGGTCCACCAAG
JMFS120A07+ GCCACCATGGCTCGTCTTTCTTGTCTTCATGTCCCTTTTGAACAACCTCGGTCCACCAAG
JMFN034I07+ GCCACCATGGCTCGTCTTTCTTGTCTTCATGTCCCTTTTGAACAACCTCGGTCCACCAAG
JMFN043G08+ GCCACCATGGCTCGTCTTTCTTGTCTTCATGTCCCTTTTGAACAACCTCGGTCCACCAAG
JMFN041O16+ TTCTTGTCTTCATGTCCC-TTTGAACAACCTCGGTCCACCAAG
                      ____________________________________________________________
consensus GCCACCATGGCTCGTCTTTCTTGTCTTCATGTCCCTTTTGAACAACCTCGGTCCACCAAG
 
. : . : . : . : . : . :
rJMFF010G06- CTTGCAG
rJMFF032A12- CTTGCA-GTTCTGT
rJMFF038C11- CTTGCAGGTTCTGTGTCCGTCCAAACCATGATGTCATTCTTGTAGTAGAAATTGCAGTAT
JMFN036I16+ CTTGCA-GTTCTGTGTCCGTCCAAACCATGATGTCATTCTTGTAGTAGAAATTGCAGTAT
rJMFF032G23- CTTGCA-GTTCTGTGTCCGTCCAAACCATGATGTCATTCTTGTAGTAGAAATTGCAGTAT
JMFN029G13+ CTTGCA-GTTCTGTGTCCGTCCAAACCATGATGTCATTCTTGTAGTAGAAATTGCAGTAT
rJMFF027N22- CTTGCA-GTTCTGTGTCCGTCCAAACCATGATGTCATTCTTGTAGTAGAAATTGCAGTAT
JMFS120A07+ CTTGCA-GTTCTGTGTCCGTCCAAACCATGATGTCATTCTTGTAGTAGAAATTGCAGTAT
JMFN034I07+ CTTGCA-GTTCTGTGTCCGTCCAAACCATGATGTCATTCTTGTAGTAGAAATTGCAGTAT
JMFN043G08+ CTTGCA-GTTCTGTGTCCGTCCAAACCATGATGTCATTCTTGTAGTAGAAATTGCAGTAT
JMFN041O16+ CTTGCA-GTTCTGTGTCCGTCCAAACCATGATGTCATTCTTGTAGTAGAAATTGCAGTAT
                      ____________________________________________________________
consensus CTTGCA-GTTCTGTGTCCGTCCAAACCATGATGTCATTCTTGTAGTAGAAATTGCAGTAT
 
. : . : . : . : . : . :
rJMFF038C11- TCAGTGACC
JMFN036I16+ TCAGTGACCCAGGTCTTGATTGCTGTCCATATTTCAAGCCCATCAACCGCATATGGATAA
rJMFF032G23- TCAGTGACCCAGGTCTTGATTGCTGTCCATATTTCAAGCCCATCAACCGCATATGGATAA
JMFN029G13+ TCAGTGACCCAGGTCTT
rJMFF027N22- TCAGTGACCCAGGTCTTGATTGCTGTCCATATTTCNAGCCCATCAACCGCATATGGATAA
JMFS120A07+ TCAGTGACCCAGGTCTTGATTGCTGTCCATATTTCAAGCCCATCAACCGCATATGGATAA
JMFN034I07+ TCAGTGACCCAGGTCTTGATTGCTGTCCATATTTCAAGCCCATCAACCGCATATGGATAA
JMFN043G08+ TCAGTGACCCAGGTCTTGATTGCTGTCCATATTTCAAGCCCATCAACCGCATATGGATAA
JMFN041O16+ TCAGTGACCCAGGTCTTGATTGCTGTCCATATTTCAAGCCCATCAACCGCATATGGATAA
JMFN018E20+ CAGGTCTTGATTGCTGTCCATATTTCAAGCCCATCAACCGCATATGGATAA
JMFS155A12+ GCATATGGAT-A
                      ____________________________________________________________
consensus TCAGTGACCCAGGTCTTGATTGCTGTCCATATTTCAAGCCCATCAACCGCATATGGATAA
 
. : . : . : . : . : . :
JMFN036I16+ TCTTCGATCAGTAA
rJMFF032G23- TCTTCGATCAGTAAGCGTACCCC
rJMFF027N22- TCTTCGATCAGTAAGCGTACCCC
JMFS120A07+ TCTTCGATCAGTAAGCGTACCCCGTGTGGTGAAGATAGGTCCACCACGGCCATTCCTCTG
JMFN034I07+ TCTTCGATCAGTAAGCGTACCCCGTGTGGTGAAGATAGGTCCACCACGGCCATTCCTCTG
JMFN043G08+ TCTTCGATCAGTAAGCGTACCCCGTGTGGTGAAGATAGGTCCACCACGGCCATTCCTCTG
JMFN041O16+ TCTTCGATCAGTAAGCGTACCCCGTGTGGTGAAGATAGGTCCACCACGGCCATTCCTCTG
JMFN018E20+ TCTTCGATCAGTAAGCGTACCCCGTGTGGTGAAGATAGGTCCACCACGGCCATTCCTCTG
JMFS155A12+ TCTTCGATCAGTAAGCGTACNCCGTGTGGTGAAGATAGGTCCACCACGGCCATTCCTCTG
                      ____________________________________________________________
consensus TCTTCGATCAGTAAGCGTACCCCGTGTGGTGAAGATAGGTCCACCACGGCCATTCCTCTG
 
. : . : . : . : . : . :
JMFS120A07+ TTTATGAGGTCATTAGGAAGAGAATGATTAGGGAAAACCC
JMFN034I07+ TTTATGAGGTCATTAGGAAGAGAATGATTAGGGAAAACCCAATTTTTATACAAAACGGCA
JMFN043G08+ TTTATGAGGTCATTAGGAAGAGAATGATTAGGGAAAACCCAATTTTTATACAAAACGGCA
JMFN041O16+ TTTATGAGGTCATTAGGAAGAGAATGATTAGGGAAAACCCAATTTTTATACAAAACGGCA
JMFN018E20+ TTTATGAGGTCATTAGGAAGAGAATGATTAGGGAAAACCCAATTTTTATACAAAACGGCA
JMFS155A12+ TTTATGAGGTCATTAGGAAGAGAATGATTAGGGAAAACCCAATTTTTATACAAAACGGCA
                      ____________________________________________________________
consensus TTTATGAGGTCATTAGGAAGAGAATGATTAGGGAAAACCCAATTTTTATACAAAACGGCA
 
. : . : . : . : . : . :
JMFN034I07+ GACATTTCCATTGCA
JMFN043G08+ GACATTTCCATTGCATATTTTCCAGGAAGACATGATAACTCAATAACTCCATCAGCGTTA
JMFN041O16+ GACATTTCCATTGCATATTTTCCAGGAAGACATGATAACTCAATAACTCCATCAGCGTTA
JMFN018E20+ GACATTTCCATTGCATATTTTCCAGGAAGACATGATAACTCAATAACTCCATCAGCGTTA
JMFS155A12+ GACATTTCCATTGCATATTTTCCAGGAAGACATGATAACTCAATAACTCCATCAGCGTTA
                      ____________________________________________________________
consensus GACATTTCCATTGCATATTTTCCAGGAAGACATGATAACTCAATAACTCCATCAGCGTTA
 
. : . : . : . : . : . :
JMFN043G08+ GTGAGGAGCTGTCGGCCCAAAGCATTGATATGCATTGTGTCACGGAAATGGGGGTGGAGG
JMFN041O16+ GTGAGGAGCTGTCGGCCCAAAGCATTGATATGCATTGTGTCACGGAAATGGGGGTGGAGG
JMFN018E20+ GTGAGGAGCTGTCGGCCCAAAGCATTGATATGCATTGTGTCACGGAAATGGGGGTGGAGG
JMFS155A12+ GTGAGGAGCTGTCGGCCCAAAGCATTGATATGCATTGTGTCACGGAAATGGGGGTGGAGG
JMFF034K09+ CGGAAATGGGGGTGGAGG
JMFS077E05+ GCTGTCGGCCCAAAGCATTGATATGCATTGTGTCACGGAAATGGGGGTGGAGG
                      ____________________________________________________________
consensus GTGAGGAGCTGTCGGCCCAAAGCATTGATATGCATTGTGTCACGGAAATGGGGGTGGAGG
 
. : . : . : . : . : . :
JMFN043G08+ AGCTTGTAAATCGGGTGAAGAAAGCTTAGCTGTCTATTTGTTGCAA
JMFN041O16+ AGCTTGTAAATCGGGTGAAGAAAGCTTAGCTGTCTATTTGTTGCAATTATAATTGGCTCA
JMFN018E20+ AGCTTGTAAATCGGGTGAAGAAAGCTTAGCTGTCTATTTGTTGCAATTATAATTGGCTCA
JMFS155A12+ AGCTTGTAAATCGGGTGAAGAAAGCTTAGCTGTCTATTTGTTGCAATTATAATTGGCTCA
JMFF034K09+ AGCTTGTAAATCGGGTGAAGAAAGCTTAGCTGTCTATTTGTTGCAATTATAATTGGCTCA
JMFS077E05+ AGCTTGTAAATCGGGTGAAGAAAGCTTAGCTGTCTATTTGTTGCAATTATAATTGGCTCA
                      ____________________________________________________________
consensus AGCTTGTAAATCGGGTGAAGAAAGCTTAGCTGTCTATTTGTTGCAATTATAATTGGCTCA
 
. : . : . : . : . : . :
JMFN041O16+ ATCACAGCATGAGTGTTCAACCAATGGCTGATGAGTTGATGGACTCCAGAGTCGTTGGTG
JMFN018E20+ ATCACAGCATGAGTGTTCAACCAATGGCTGATGAGTTGATGGACTCCAGAGTCGTTGGTG
JMFS155A12+ ATCACAGCATGAGTGTTCAACCAATGGCTGATGAGTTGATGGACTCCAGAGTCGTTGGTG
JMFF034K09+ ATCACAGCATGAGTGTTCAACCAATGGCTGATGAGTTGATGGACTCCAGAGTCGTTGGTG
JMFS077E05+ ATCACAGCATGAGTGTTCAACCAATGGCTGATGAGTTGATGGACTCCAGAGTCGTTGGTG
JMFS147E01+ CTGATGAGTTGATGGACTCCAGAGTCGTTGGTG
                      ____________________________________________________________
consensus ATCACAGCATGAGTGTTCAACCAATGGCTGATGAGTTGATGGACTCCAGAGTCGTTGGTG
 
. : . : . : . : . : . :
JMFN041O16+ GCTGCATAAGCTTTCGCCAGTTGCCAGATTGAACCCTCGACGCCTTGTTCAGCTGGGGTG
JMFN018E20+ GCTGCATAAGCTTTCGCCAGTTGCCAGATTGAACCCTCGACGCCTTGTTCAGCTGGGGTG
JMFS155A12+ GCTGCATAAGCTTTCGCCAGTTGCCAGATTGAACCCTCGACGCCTTGTTCAGCTGGGGTG
JMFF034K09+ GCTGCATAAGCTTTCGCCAGTTGCCAGATTGAACCCTCGACGCCTTGTTCAGCTGGGGTG
JMFS077E05+ GCTGCATAAGCTTTCGCCAGTTGCCAGATTGAACCCTCGACGCCTTGTTCAGCTGGGGTG
JMFS147E01+ GCTGCATAAGCTTTCGCCAGTTGCCAGATTGAACCCTCGACGCCTTGTTCAGCTGGGGTG
                      ____________________________________________________________
consensus GCTGCATAAGCTTTCGCCAGTTGCCAGATTGAACCCTCGACGCCTTGTTCAGCTGGGGTG
 
. : . : . : . : . : . :
JMFN041O16+ TACACATTGCTAACACAA
JMFN018E20+ TACACATTGCTAACACAACCAAATTTATCGCCAAGAGGGTGGGGCAAGCTAAGTTCAATA
JMFS155A12+ TACACATTGCTAACACAACCAAATTTATCGCCAAGAGGGTGGGGCAAGCTAAGTTCAATA
JMFF034K09+ TACACATTGCTAACACAACCAAATTTATCGCCAAGAGGGTGGGGCAAGCTAAGTTCAATA
JMFS077E05+ TACACATTGCTAACACAACCAAATTTATCGCCAAGAGGGTGGGGCAAGCTAAGTTCAATA
JMFF036E19+ ATA
JMFS147E01+ TACACATTGCTAACACAACCAAATTTATCGCCAAGAGGGTGGGGCAAGCTAAGTTCAATA
                      ____________________________________________________________
consensus TACACATTGCTAACACAACCAAATTTATCGCCAAGAGGGTGGGGCAAGCTAAGTTCAATA
 
. : . : . : . : . : . :
JMFN018E20+ GCTATTGGCCTCAAAGTGCCATCCTTCTGCAAGAACAGCAAAGTCCTTGTAGCATAGATT
JMFS155A12+ GCTATTGGCCTCAAAGTGCCATCCTTCTGCAAGAACAGCAAAGTCCTTGTAGCATAGATT
JMFF034K09+ GCTATTGGCCTCAAAGTGCCATCCTTCTGCAAGAACAGCAAAGTCCTTGTAGCATAGATT
JMFS077E05+ GCTATTGGCCTCAAAGTGCCATCCTTCTGCAAGAACAGCAAAGTCCTTGTAGCATAGATT
JMFF036E19+ GCTATCGGCCTCAAAGTGCCATCCTTGAGCAAGAAGAGCAAAGTCCTTGTAGCATAGATT
JMFS147E01+ GCTATTGGCCTCAAAGTGCCATCCTTCTGCAAGAACAGCAAAGTCCTTGTAGCATAGATT
                      ____________________________________________________________
consensus GCTATTGGCCTCAAAGTGCCATCCTTCTGCAAGAACAGCAAAGTCCTTGTAGCATAGATT
 
. : . : . : . : . : . :
JMFN018E20+ TTCCTGTCCGTG
JMFS155A12+ TTCCTGTCCGTGTTGGCATTTATTCGCCTTGCATATAGCATTATTCCATCATGGTGGTCC
JMFF034K09+ TTCCTGTCCGTGTTGGCATTTATTCGCCTTGCATATAGCATTATTCCATCATGGTGGTCC
JMFS077E05+ TTCCTGTCCGTGTTGGCATTTATTCGCCTTGCATATAGCATTATTCCATCATGGTGGTCC
JMFF036E19+ TTCCTGTCCGTGTTGTCATTTATCCGTCTTGCATATAGCGTTATCGCATCGTGGTGATCC
JMFS147E01+ TTCCTGTCCGTGTTGGCATTTATTCGCCTTGCATATAGCATTATTCCATCATGGTGGTCC
                      ____________________________________________________________
consensus TTCCTGTCCGTGTTGGCATTTATTCGCCTTGCATATAGCATTATTCCATCATGGTGGTCC
 
. : . : . : . : . : . :
JMFS155A12+ AGTATGAATACTCGGTTACTCCAAATGGCC
JMFF034K09+ AGTATGAATACTCGGTTACTCCAAATGGCCTGCTCAACTGTTAGCCCATCTAACTTATCT
JMFS077E05+ AGTATGAATACTCGGTTACTCCAAATGGCCTGCTCAACTGTTAGCCCATCTAACTTATCT
JMFF036E19+ AGGATGAATAACCTCTTGCTCTCAATGGCCTGCTCAACAGTTAGTCCATCCAACTTATCT
JMFS147E01+ AGTATGAATACTCGGTTACTCCAAATGGCCTGCTCAACTGTTAGCCCATCTAACTTATCT
JMFS092F08+ TAGCCCATCTAACTTATCT
                      ____________________________________________________________
consensus AGTATGAATACTCGGTTACTCCAAATGGCCTGCTCAACTGTTAGCCCATCTAACTTATCT
 
. : . : . : . : . : . :
JMFF034K09+ GCAATGTGTTCTCTTGTTATAGTGCTGGTATGGTCTACATACACTTTGGGGTCCAGCGTG
JMFS077E05+ GCAATGTGTTCTCTTGTTATAGTGCTGGTATGGTCTCCATACACTTTGGGGTCCAGCGTG
JMFF036E19+ GCAATGTCTTCTCTGGTTATAGTGCAGGTATGGTCTCCATAGACTTTGGGGTCAAGGGTG
JMFS147E01+ GCAATGTGTTCTCTTGTTATAGTGCTGGTATGGTCTCCATACACTTTGGGGTCCAGCGTG
JMFS092F08+ GCAATGTGTTCTCTTGTTATAGTGCTGGTATGGTCTCCATACACTTTGGGGTCCAGCGTG
                      ____________________________________________________________
consensus GCAATGTGTTCTCTTGTTATAGTGCTGGTATGGTCTCCATACACTTTGGGGTCCAGCGTG
 
. : . : . : . : . : . :
JMFF034K09+ CTTCTTGGTGGGAACACTTGGAGGCGACTAATGCAGACTGGGTTCACTCCGGCAAGCATT
JMFS077E05+ CTTCTTGGTGGGAACACTTGGAGGCGACTAATGCAGACTGGGTTCACTCCGGCAAGCATT
JMFF036E19+ CTTCTTTGTGGGAACATTTGGAGGCGACTAATGCTGACGGGGTTCACTCCGGCCAACATT
JMFS147E01+ CTTCTTGGTGGGAACACTTGGAGGCGACTAATGCAGACTGGGTTCACTCCGGCAAGCATT
JMFS092F08+ CTTCTTGGTGGGAACACTTGGAGGCGACTAATGCAGACTGGGTTCACTCCGGCAAGCATT
                      ____________________________________________________________
consensus CTTCTTGGTGGGAACACTTGGAGGCGACTAATGCAGACTGGGTTCACTCCGGCAAGCATT
 
. : . : . : . : . : . :
JMFF034K09+ TCTCTCGCGAATTCCTCATCTGTT
JMFS077E05+ TCTCTCGCGAATTCCTCATCTGTTCTCCA
JMFF036E19+ TCTCTGGCGAATTCCTCGTCGGTTCTCCAGGCAGTCTTGTTATCTGCAATAACTTGTGGG
JMFS147E01+ TCTCTCGCGAATTCCTCATCTGTTCTCCATGCGGTTTTGCTAGCTCCAATAACTTGTGGC
JMFS092F08+ TCTCTCGCGAATTCCTCATCTGTTCTCCATGCGGTTTTGCTAGCTCCAATAACTTGTGGC
                      ____________________________________________________________
consensus TCTCTCGCGAATTCCTCATCTGTTCTCCATGCGGTTTTGCTAGCTCCAATAACTTGTGGC
 
. : . : . : . : . : . :
JMFF036E19+ GTTGGGAATTTGAACATTTTTTCGCCATCGCTTCTGAGGAGTTCTTTGATCATCTCCAAA
JMFS147E01+ GTTGGGAATTTGAACAAATTTTCCCCATCACTTCGGAGAACTTCCTTGGTTATCTCAAGA
JMFS092F08+ GTTGGGAATTTGAACAAATTTTCCCCATCACTTCGGAGAACTTCCTTGGTTATCTCAAGA
                      ____________________________________________________________
consensus GTTGGGAATTTGAACAAATTTTCCCCATCACTTCGGAGAACTTCCTTGGTTATCTCAAGA
 
. : . : . : . : . : . :
JMFF036E19+ GGAGTGTTCTTCTGGATGTG
JMFS147E01+ TTAGTGTTCTTCTGGATGTGTTCCAGCAATAACCCCCTCGATAACC
JMFS092F08+ TTAGTGTTCTTCTGGATGTGTTCCAGCAATAACCCCCTCGATAACCCTCCCTCGTACAAC
                      ____________________________________________________________
consensus TTAGTGTTCTTCTGGATGTGTTCCAGCAATAACCCCCTCGATAACCCTCCCTCGTACAAC
 
. : . : . : . : . : . :
JMFS092F08+ GAATTCATATCGTCGAAGCTGTCAAACTCATTTTGGGTGGCATCAAACCGGGAAGCAATA
JMSF033H21+ CGAAGCTGTCAAACTCATTTTGGGTGGCATCAAACCGGGAAGCAATA
                      ____________________________________________________________
consensus GAATTCATATCGTCGAAGCTGTCAAACTCATTTTGGGTGGCATCAAACCGGGAAGCAATA
 
. : . : . : . : . : . :
JMFS092F08+ AAAGGGATAACAACTTGCCCAATGGACTTCAATGCATAACCAAGAAAATCCGATTGTTTA
JMSF033H21+ AAAGGGATAACAACTTGCCCAATGGACTTCAATGCATAACCAAGAAAATCCGATTGTTTA
                      ____________________________________________________________
consensus AAAGGGATAACAACTTGCCCAATGGACTTCAATGCATAACCAAGAAAATCCGATTGTTTA
 
. : . : . : . : . : . :
JMFS092F08+ AGATGCCCAAATTTCTCGTCCCTCGGCACATATATCTCAGCAACCGGTAATAATGGAAGT
JMSF033H21+ AGATGCCCAAATTTCTCGTCCCTCGGCACATATATCTCAGCAACCGGTAATAATGGAAGT
JMFS151H12+ TGCCCAAATTTCTCGTCCCTCGGCACATATATCTCAGCAACCGGTAATAATGGAAGT
JMFS050G05+ CAGCAACCGGTAATAATGGAAGT
                      ____________________________________________________________
consensus AGATGCCCAAATTTCTCGTCCCTCGGCACATATATCTCAGCAACCGGTAATAATGGAAGT
 
. : . : . : . : . : . :
JMFS092F08+ CTACTTTCATACTTTGGATCTGTCTTCGTCATTTTCCGACCAGTTCTACCGCGACGAGGA
JMSF033H21+ CTACTTTCATACTTTGGATCTGTCTTCGTCATTTTCCGACCAGTTCTACCGCGACGAGGA
JMFS002A08+ ACTTTGGATCTGTCTTCGTCATTTTCCGACCAGTTCTACCGCGACGAGGA
JMFS151H12+ CTACTTTCATACTTTGGATCTGTCTTCGTCATTTTCCGACCAGTTCTACCGCGACGAGGA
JMFS050G05+ NNACTTTCATACTTGGGATCTGTCTTCGTCATTTTCCGACCAGTTCTACCGCGACGAGGA
JMFS085G10+ ACTTTGGATCTGTCTTCGTCATTNTCCGACCAGTTCTACCGCGACGAGGA
JMFS136A06+ ACCGCGACGAGGA
                      ____________________________________________________________
consensus CTACTTTCATACTTTGGATCTGTCTTCGTCATTTTCCGACCAGTTCTACCGCGACGAGGA
 
. : . : . : . : . : . :
JMFS092F08+ TAAGGGTATTCTGGGTTTCCTCCGAGGATGGGGCGAGGCTTGCCATTGTCGGGATCACCC
JMSF033H21+ TAAGGGTATTCTGGGTTTCCTCCGAGGATGGGGCGAGGCTTGCCATTGTCGGGATCACCC
JMFS002A08+ TAAGGGTATTCTGGGTTTCCTCCGAGGATGGGGCGAGGCTTGCCATTGTCGGGATCACCC
JMFS151H12+ TAAGGGTATTCTGGGTTTCCTCCGAGGATGGGGCGAGGCTTGCCATTGTCGGGATCACCC
JMFS050G05+ TAAGGGTATTCTGGGTTTCCTCCGAGGATGGGGCGAGGCTTGCCATTGTCGGGATCACCC
JMFS085G10+ TAAGGGTATTCTGGGTTTCCTCCGAGGATGGGGCGAGGCTTGCCATTGTCGGGATCACCC
JMFS136A06+ TAAGGGTATTCTGGGTTTCCTCCGAGGATGGGGCGAGGCTTGCCATTGTCGGGATCACCC
JMFS077D01+ TGCCATTGTCGGGATCACCC
JMFS121C11+ GAGGATGGGGCGAGGCTTGCCATTGTCGGGATCACCC
JMFS151C11+ GAGGATGGGGCGAGGCTGCCCATTGTCGGGATCACCC
JMFS110H11+ ATTGTCGGGATCACCC
JMFS119F03+ TCACCC
JMFS075A04+ ATCACCC
JMFS064B03+ GGGATCACNC
JMFS076D02+ GTCGGGATCACCC
JMFS067D12+ ATCACCC
JMFS102G08+ ACCC
JMFS130H10+ CACCC
JMFS026E02+ TCGGGATCACCC
JMFS046F06+ GGGATCACNC
JMFS139E12+ TTGTCGGGATCACCC
JMFS145C03+ GTCGGGATCACCC
JMFS037D04+ GGGATCACCC
JMFS156C06+ CGGGATCACCC
JMFS028H04+ CC
JMFS079E12+ TCGGGATCACCC
JMFS120H03+ C
JMFS073H06+ C
JMFS081F12+ C
JMFS114G01+ C
JMFS033B09+ GGATCACNC
JMFS090D07+ CACCC
JMFS066A12+ CACCC
JMFS147H02+ CC
JMFS150H11+ CACCC
JMFS079B03+ CC
JMFS086H10+ CCC
JMFS059A12+ CACCC
                      ____________________________________________________________
consensus TAAGGGTATTCTGGGTTTCCTCCGAGGATGGGGCGAGGCTTGCCATTGTCGGGATCACCC
 
. : . : . : . : . : . :
JMFS092F08+ AAGTCATTGTAG
JMSF033H21+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS002A08+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS151H12+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS050G05+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS085G10+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS136A06+ AAGTCATGNTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS077D01+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTNGCGTTCTCCGGTGCCG
JMFS121C11+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS151C11+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS110H11+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS119F03+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS075A04+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS064B03+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS076D02+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS067D12+ AAGTCATGNTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS102G08+ AAGTCATGNTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS050B08+ AGTCATGTTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS130H10+ AAGTCATGNTAGTAATCATAGTCATAAACCCTGTCCCACTCCTGNCGTTCTCCGGTGCCG
JMFS026E02+ AAGTCATGNTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS046F06+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS139E12+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS145C03+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTAGCGTTCTCCGGTGCCG
JMFS037D04+ AAGTCATGNTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGT-CTCCGGTGCCG
JMFS156C06+ AAGTCATGNTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS028H04+ AAGTCATGNTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS079E12+ AAGTCATGNTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS120H03+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS073H06+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS081F12+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS114G01+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS095E05+ GTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS137D05+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS127B04+ TCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS145B09+ AGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS055G02+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS130B02+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS080B07+ GTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS118B02+ GTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS033B09+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS090D07+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS066A12+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS147H02+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS112C02+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS063C05+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS073C08+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS106H05+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS150H11+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS079B03+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS098E03+ ATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS086H10+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS070C10+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS061G03+ ATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS086C05+ GTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS145E08+ TAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS167B03+ TAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS018D04+ GTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS110D01+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS153E02+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS167B05+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS167A10+ GTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS008E10+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS065G07+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS076F02+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS090D03+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS061A10+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS115C06+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS128F03+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS141A12+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS142B06+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS070G07+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS130F01+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS041B01+ GTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS079B06+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS104A04+ TAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS067A02+ TAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS163C02+ GTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS105H04+ AGTAATCATAGTCATAAACCCTGTCCCACTCATTGCGTTCTCCGGTGCCG
JMFS059A12+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS128C07+ AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS097E09+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTGCGTTTCTCCGGTGCCG
JMFS088C06+ AGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS112C09+ ATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS141D12+ TCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS007D10+ ATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS059G04+ ATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS063A06+ ATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS112A12+ GTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS074G06+ GTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS102C10+ GTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS071H12+ TCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS126H05+ TCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS140F07+ TCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS077H01+ GTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS059C12+ TAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS111F02+ AATCATAGTCATAAACCCTGTCCCACTCCTTG-GTTCTCCGGTGCCG
JMFS130B07+ GTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS155F07+ ATCATAGTCATAAACCCTGTCCCACTCCTGCGTTTCTCCGGTGCCG
JMFS152C08+ TAATCATAGTCATAAACCCTGTCCCACTCCTGCGTTTCTCCGGTGCCG
JMFS147C11+ AATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS033D08+ ATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS045E01+ ATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS034D02+ GTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS147C01+ TAGTCATAAACCCTGTCCCACTCCTGCGTTTCTCCGGTGCCG
JMFS040E10+ CATAAACCCTGTCCCACTCCTGCGTTTCTCCGGTGCCG
JMFS151A02+ ATAGTCATAAACCCTGTCCCACTCCTGCGTTTCTCCGGTGCCG
JMFS126E05+ AGTCATAAACCCTGTCCCACTCCTGCGTTTCTCCGGTGCCG
JMFS167A04+ AGTCATAAACCCTGTCCCACTCCTGCGTTTCTCCGGTGCCG
JMFS034A07+ AGTCATAAACCCTGTCCCACTCCTGCGTTTCTCCGGTGCCG
JMFS140H06+ AGTCATAAACCCTGTCCCACTCCTGCGTTTCTCCGGTGCCG
JMFS112D08+ TAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS138E06+ AGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS156C11+ AGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS134G11+ AGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS133C04+ AGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS138D08+ AGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS025B06+ AGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS127A07+ AGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS076A06+ AGTCATAAACCCTGTCCCACTCCATGCGTTCTCCGGTGCCG
JMFS094G02+ AGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS055D12+ TAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS096E09+ CATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS076F06+ CATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS078H09+ CATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS140H11+ ATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS129H05+ ATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS072G06+ CATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS090D04+ AGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS152G07+ AGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS152A10+ AGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS152A03+ AGTCATAAACCCTGTCCCACTCCTTGCGTCTNCCGGTGCCG
JMFS012A06+ AGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS048E08+ ATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS104D08+ TCATAGTCATAAACCCTGTCCCACTCCTGCGTTTCTCCGGTGCCG
JMFS139B11+ ACCCTGTCCCACTCCTGCGTTTCTCCGGTGCCG
JMFS132C07+ ACCCTGTCCCACTCCTGCGTTTCTCCGGTGCCG
JMFS035H03+ CCCTGTCCCACTCCTGCGTTTCTCCGGTGCCG
JMFS020A12+ AACCCTGTCCCACTCCTGCGTTTCTCCGGTGCCG
JMFS028B02+ TAAACCCTGTCCCACTCCTGCGTTTCTCCGGTGCCG
JMFS026D11+ TAAACCCTGTCCCACTCCTGCGTTTCTCCGGTGCCG
JMFF041O21+ CATAGTCATAANCCCTGTCCCACTCCTGCAGTTCTCCGGTGCCG
JMFS151F12+ AACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS057F07+ AACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS063G06+ AACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS074B07+ AACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS074F07+ AACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS082F01+ AACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS084E08+ AACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS129A11+ AACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS120G10+ TCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS096G04+ TCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS084B10+ GTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS074B10+ AAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS041G10+ CATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS144H07+ CATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS144B12+ GTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS140G06+ ACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS112E10+ CCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS080F04+ ACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS092H08+ CCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS156G04+ AACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS037C08+ GTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS143D04+ AACCCTGTCCCACTCCTTGCGTTATCCGGTGCCG
JMFF045C05+ ACTCCTGCGTTTCTCCGGTGCCG
JMFS022E09+ CCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS127F10+ CTTGCGTTCTCCGGTGCCG
JMFS022E10+ TGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS017E04+ AACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS099G02+ GTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS168F10+ CTTGCGTTCTCCGGTGCCG
JMFS051E02+ CCACTCCTTGCGTTCTCCGGTGCCG
JMFS054C11+ ATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS044F01+ AAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS085F07+ CTTGCGTTCTCCGGTGCCG
JMFS137H05+ TGTCCCACTCCTTGCGTTCTCCGGTGCCG
JMFS137C07+ CCGGTGCCG
JMFS161H10+ CTTGCGTTCTCCGGTGCCG
JMFS116H12+ CG
JMFS016F03+ TCCGGTGCCG
JMFS003B02+ CCGGTGCCG
JMFS123B03+ CCGGTGCCG
JMFS114H07+ GCCG
JMFS051A10+ TCCGGTGCCG
JMFF044A01+ GTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
                      ____________________________________________________________
consensus AAGTCATTGTAGTAATCATAGTCATAAACCCTGTCCCACTCCTTGCGTTCTCCGGTGCCG
 
. : . : . : . : . : . :
JMSF033H21+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS002A08+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS151H12+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS050G05+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS085G10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS136A06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS077D01+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS121C11+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS151C11+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS110H11+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS119F03+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS075A04+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS064B03+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS076D02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS067D12+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS102G08+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS050B08+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS130H10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS026E02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS046F06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS139E12+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS145C03+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGACGGAGCGGCGCCGGCGTTTG
JMFS037D04+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS156C06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS028H04+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS079E12+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS120H03+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS073H06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS081F12+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS114G01+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS095E05+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS137D05+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS127B04+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS145B09+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS055G02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS130B02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS080B07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS118B02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS033B09+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS090D07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS066A12+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS147H02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS112C02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS063C05+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS073C08+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS106H05+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS150H11+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS079B03+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS098E03+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS086H10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS070C10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS061G03+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS086C05+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS145E08+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS167B03+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS018D04+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS110D01+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS153E02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS167B05+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS167A10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS008E10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS065G07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS076F02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS090D03+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS061A10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS115C06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS128F03+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS141A12+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS142B06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS070G07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS130F01+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS041B01+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS079B06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS104A04+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS067A02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS163C02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS105H04+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS059A12+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS128C07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS097E09+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS088C06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS112C09+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS141D12+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS007D10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS059G04+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS063A06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS112A12+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS074G06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS102C10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS071H12+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS126H05+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS140F07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS077H01+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS059C12+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS111F02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS130B07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS155F07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS152C08+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS147C11+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS033D08+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS045E01+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS034D02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS147C01+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS040E10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS151A02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS126E05+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS167A04+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS034A07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS140H06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS112D08+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS138E06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS156C11+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS134G11+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS133C04+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS138D08+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS025B06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS127A07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS076A06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS094G02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS055D12+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS096E09+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS076F06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS078H09+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS140H11+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS129H05+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS072G06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS090D04+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS152G07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS152A10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS152A03+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS012A06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS048E08+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS104D08+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS139B11+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS132C07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS035H03+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS020A12+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS028B02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS026D11+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFF041O21+ TCTCCTCTCAGGATCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS151F12+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS057F07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS063G06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS074B07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS074F07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS082F01+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS084E08+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS129A11+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS120G10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS096G04+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS084B10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS074B10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS041G10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS144H07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS144B12+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS140G06+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS112E10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS080F04+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS092H08+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS156G04+ TCTCCTCTCAGGTTATTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS037C08+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS143D04+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFF045C05+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS022E09+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS127F10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS022E10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS017E04+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS099G02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS168F10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGNCGGAGCGGCGCCGGCGTTTG
JMFS051E02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS054C11+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS044F01+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS085F07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS137H05+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS137C07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS161H10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS116H12+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS016F03+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS003B02+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS123B03+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS123E04+ AGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS157B11+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS018C08+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS121G11+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS003A01+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS162F03+ CAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS002C12+ CAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS005E08+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS027B05+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS121E02+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS123G04+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS152G04+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS023C10+ CAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS019A09+ CGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS001A09+ AGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS121B01+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS123H09+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS032F06+ TCAGCTCCGCTT-CCCTGAAGGGNCGGAGCGGCGCCGGCGTTTG
JMFS121F06+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS114H07+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS054C02+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS161F05+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS019A05+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS122D05+ CTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS162G07+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS006F05+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS161F04+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS125H02+ TTCCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS023F10+ AGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS122D10+ CAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS165G08+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS039F10+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS005G03+ TCAGCTCCGCTT-CCCTGAAGGGCGGAAGCGGCGCCGGCGTTTG
JMFS150A10+ CAGCTCCGCTT-CCCTGAAGGG-CGGAGCGGCGCCGGCGTTTG
JMFS051A10+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS031B12+ CAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS019F09+ TCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS019C04+ AGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS011H02+ CAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGACGGAGCGGCGCCGGCGTTTG
JMFF044A01+ TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFF031B11+ AGCTCCGCTTCCCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFF034B01+ CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFF038C11+ GAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFF032A12+ AAGGGGCGGAGCGGCGCCGGCGTTTG
JMFF032C18+ CGGAGCGGCGCCGGCGTTCG
JMFF028K21+ TCTTCAGCTCCGCTTCCCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFS023D10+ CGGCGTTTG
JMFS114H02+ TTG
JMFS159E12+ GCGTTTG
JMFS148F07+ CGCCGGCGTTTG
JMFS045E10+ GTTTG
JMFS045D07+ CGGAGCGGCGCCGGCGTTTG
JMFF019J03+ TGAAGGGGCGGAGCGGCGCCGGCGTTTG
JMFF027N22+ GGCGGAGCGGCGCCGGCGTTTG
JMFF047D06+ GAGCGGCGCCGGCGTTTG
JMSF037O22+ CTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
                      ____________________________________________________________
consensus TCTCCTCTCAGGTTCTTCAGCTCCGCTT-CCCTGAAGGGGCGGAGCGGCGCCGGCGTTTG
 
. : . : . : . : . : . :
JMSF033H21+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS002A08+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS151H12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS050G05+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS085G10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS136A06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS077D01+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS121C11+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS151C11+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS110H11+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS119F03+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS075A04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS064B03+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS076D02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS067D12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS102G08+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS050B08+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS130H10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS026E02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS046F06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS139E12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS145C03+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS037D04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS156C06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS028H04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS079E12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS120H03+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS073H06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS081F12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS114G01+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS095E05+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS137D05+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS127B04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS145B09+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS055G02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS130B02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS080B07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS118B02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS033B09+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS090D07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS066A12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS147H02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS112C02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS063C05+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS073C08+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS106H05+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS150H11+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS079B03+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS098E03+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS086H10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS070C10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS061G03+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS086C05+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS145E08+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS167B03+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS018D04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS110D01+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS153E02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS167B05+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS167A10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS008E10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS065G07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS076F02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS090D03+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS061A10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS115C06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS128F03+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS141A12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS142B06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS070G07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS130F01+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS041B01+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS079B06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS104A04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS067A02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS163C02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS105H04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS059A12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS128C07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS097E09+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS088C06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS112C09+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS141D12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS007D10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS059G04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS063A06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS112A12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS074G06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS102C10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS071H12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS126H05+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS140F07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS077H01+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS059C12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS111F02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS130B07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS155F07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS152C08+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS147C11+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTA--GGCGGG
JMFS033D08+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS045E01+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS034D02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS147C01+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS004B09+ GGG
JMFS004H03+ TCGTAGTTGTACTTATCGGCGGG
JMFS040E10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS151A02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS126E05+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS167A04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS034A07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS140H06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS112D08+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS138E06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS156C11+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS134G11+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS133C04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS138D08+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS025B06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS127A07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS076A06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS094G02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS055D12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS096E09+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS076F06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS078H09+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS140H11+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS129H05+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS072G06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS090D04+ GCTGGGGAGATACGCCTGGTTGGAGAAG-AGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS152G07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS152A10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS152A03+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS012A06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS048E08+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS104D08+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS139B11+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS026D10+ CGGG
JMFS132C07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS035H03+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS020A12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS028B02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS026D11+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFF041O21+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTAACGGCGGG
JMFS151F12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS057F07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS063G06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS074B07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS074F07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS082F01+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS084E08+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS129A11+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS120G10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS096G04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS084B10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS074B10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS041G10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS144H07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS144B12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS140G06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS112E10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS080F04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS092H08+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS156G04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS037C08+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS143D04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFF045C05+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS022E09+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS127F10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS022E10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS017E04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS099G02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS168F10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS051E02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS054C11+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS044F01+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS085F07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS137H05+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS137C07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS161H10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS116H12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS016F03+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS003B02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS123B03+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS123E04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS157B11+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS018C08+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS121G11+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS003A01+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS162F03+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS002C12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS005E08+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS027B05+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS121E02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS123G04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS152G04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS023C10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS019A09+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS001A09+ GCTGGGNAGATACGCCTGGTTGAAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS121B01+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS123H09+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS032F06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS121F06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS114H07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS054C02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS161F05+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS019A05+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS122D05+ GCTGGGGAGATACGCCTGGTTGGAGAAGAANACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS162G07+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS006F05+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS161F04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS125H02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS023F10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS122D10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS165G08+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS004G04+ GGTCGTAGTTGTACTTATCGGCGGG
JMFS039F10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS005G03+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS150A10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS051A10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS031B12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS019F09+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS019C04+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS011H02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAACACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFF044A01+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFF031B11+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFF034B01+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFF038C11+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFF032A12+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFF032C18+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS147H07+ ACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS150G03+ CGGTCGTAGTTGTACGTATCGNCGGG
JMFS166E03+ TTGTACTTATCGCCGGG
JMFS052A12+ CGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFF010G06+ GGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFF028K21+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS023D10+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS114H02+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS159E12+ GCTGGGGAGATACGCCTGGTTGAAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS148F07+ ACTGAGCAGATACGCCTGGTTGTAGAAGAAGACACGGTCGTAGTTGTACTTATCGGCGGG
JMFS045E10+ GCTGGGAAGATACGCTTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFS045D07+ GTTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFF019J03+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFF027N22+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFF047D06+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFF024G20+ GAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
JMFF031L07+ TTGGAGAAGAAGNCGCGGTCGTAGTTGTANTTATCGGCGGG
JMSF037O22+ GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
                      ____________________________________________________________
consensus GCTGGGGAGATACGCCTGGTTGGAGAAGAAGACGCGGTCGTAGTTGTACTTATCGGCGGG
 
. : . : . : . : . : . :
JMSF033H21+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS002A08+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS151H12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS050G05+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS085G10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS136A06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS077D01+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS121C11+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS151C11+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS110H11+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS119F03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS075A04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS064B03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS076D02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS067D12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS102G08+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS050B08+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS130H10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS026E02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS046F06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS139E12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS145C03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS037D04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS156C06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS028H04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS079E12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS120H03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS073H06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS081F12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS114G01+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS095E05+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS137D05+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS127B04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS145B09+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS055G02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS130B02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS080B07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS118B02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS033B09+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS090D07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS066A12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS147H02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS112C02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS063C05+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS073C08+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS106H05+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS150H11+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS079B03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS098E03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS086H10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS070C10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS061G03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS086C05+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS145E08+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS167B03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS018D04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS110D01+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS153E02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS167B05+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS167A10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS008E10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS065G07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS076F02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS090D03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS061A10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS115C06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS128F03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS141A12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS142B06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS070G07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS130F01+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS041B01+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS079B06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS104A04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS067A02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS163C02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS105H04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS059A12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS128C07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS097E09+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS088C06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS112C09+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS141D12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS007D10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS059G04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS063A06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS112A12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS074G06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS102C10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS071H12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS126H05+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS140F07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS077H01+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS059C12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS111F02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS130B07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACG-CGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS155F07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS152C08+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS147C11+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS033D08+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS045E01+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS034D02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS147C01+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS004B09+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGTCGGCGCCGCCGTCTTCCAGGGTG
JMFS004H03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFN029P23+ CCGCCGTCTTCCAGGGTG
JMFS040E10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS151A02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS126E05+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS167A04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS034A07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS140H06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS112D08+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS138E06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS156C11+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS134G11+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS133C04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS138D08+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS025B06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS127A07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS076A06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS094G02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS055D12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS096E09+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS076F06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS078H09+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS140H11+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS129H05+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS072G06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS090D04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS152G07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS152A10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS152A03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS012A06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS048E08+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS104D08+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS139B11+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS026D10+ GTAAACCCAA-TAAAAGCAGACGACCTGATTCGCCGATGGCGCAACCGTTTTCCAGGGTG
JMFS132C07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS035H03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS020A12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS028B02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS026D11+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFF041O21+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS151F12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS057F07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS063G06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS074B07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS074F07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS082F01+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS084E08+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS129A11+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS120G10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS096G04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS084B10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS074B10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS041G10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS144H07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS144B12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS140G06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS112E10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS080F04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS092H08+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS156G04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS037C08+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS143D04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFF045C05+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS022E09+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS127F10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS022E10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS017E04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS099G02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS168F10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS051E02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS054C11+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS044F01+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS085F07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS137H05+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS137C07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS161H10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS116H12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS016F03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS003B02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS123B03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS123E04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS157B11+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS018C08+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS121G11+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS003A01+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS162F03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS002C12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS005E08+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS027B05+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS121E02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS123G04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS152G04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS023C10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS019A09+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS001A09+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS121B01+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS123H09+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS032F06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS121F06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS114H07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS054C02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS161F05+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS019A05+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS122D05+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS162G07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS006F05+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS161F04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS125H02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS023F10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS122D10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS165G08+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS004G04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS039F10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS005G03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS150A10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS051A10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS031B12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS019F09+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS019C04+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS011H02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFF044A01+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFF031B11+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFF034B01+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFF038C11+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFF032A12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFF032C18+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS147H07+ GTAAACCCAA-GAAAAGCAGCCGATCTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS150G03+ GTAAACCCGAGGAGGAGCAGACGAACTG-GACGCCGGGGGGGCCGCCGTCTTGGAGAGTG
JMFS159D09+ AGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS166E03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS158D10+ TCCAGGGTG
JMFS052A12+ GTATACCCAA-TAAAAGCAGACGAACTG-GACGCCGGTGGTGCCGCCGTCTTCCAGGGTG
JMFF010G06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFF027G23+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFF006G02+ AAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFF028K21+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS023D10+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGAGGCGCCGCCGTCTTCCAGGGTG
JMFS114H02+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS159E12+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS148F07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFS045E10+ GTAAACCCAA-GAATAGCAGACGAACTG-GACGCCGTCGGCGCCGCCGTCTTCCAGGGTT
JMFS045D07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFF019J03+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFF027N22+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFF047D06+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFF024G20+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFF031L07+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
JMFF048O04+ GCGCCGCCGTCTTCCAGGGTG
JMSF037O22+ GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGGCGCCGTCTTCCAGGGTG
                      ____________________________________________________________
consensus GTAAACCCAA-GAAAAGCAGACGAACTG-GACGCCGGCGGCGCCGCCGTCTTCCAGGGTG
 
. : . : . : . : . : . :
JMSF033H21+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS002A08+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS151H12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS050G05+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS085G10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS136A06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS077D01+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS121C11+ AGTGTCTTGAGATAGAATTCATTGGAGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS151C11+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS110H11+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS119F03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS075A04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS064B03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS076D02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS067D12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS102G08+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS050B08+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS130H10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS026E02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS046F06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS139E12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS145C03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS037D04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS156C06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS028H04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS079E12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS120H03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS073H06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS081F12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS114G01+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS095E05+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS137D05+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS127B04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS145B09+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS055G02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS130B02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS080B07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS118B02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS033B09+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS090D07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS066A12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS147H02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS112C02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS063C05+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS073C08+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS106H05+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS150H11+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS079B03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS098E03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS086H10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS070C10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS061G03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS086C05+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS145E08+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS167B03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS018D04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS110D01+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS153E02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS167B05+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS167A10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS008E10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS065G07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS076F02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS090D03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS061A10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS115C06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS128F03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS141A12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS142B06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS070G07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS130F01+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS041B01+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS079B06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS104A04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS067A02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS163C02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS105H04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS059A12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS128C07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS097E09+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS088C06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS112C09+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS141D12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS007D10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS059G04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS063A06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS112A12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS074G06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS102C10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS071H12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS126H05+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS140F07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS077H01+ AATGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS059C12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS111F02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS130B07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS155F07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS152C08+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS147C11+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS033D08+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS045E01+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS034D02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS147C01+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS004B09+ AGTGTCTTGAGAGAGAATTCAAGGGCGGGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS004H03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFN029P23+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS040E10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS151A02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS126E05+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS167A04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS034A07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS140H06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS112D08+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS138E06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS156C11+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS134G11+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS133C04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS138D08+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS025B06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS127A07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS076A06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS094G02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS055D12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS096E09+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS076F06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS078H09+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS140H11+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS129H05+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS072G06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS090D04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS152G07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS152A10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS152A03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS012A06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS048E08+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS104D08+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS139B11+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS026D10+ AGTGTCATCAGATAGAATTCATCGGTGTGATTGTTCATGACCATGACCGCGCTGGGAACT
JMFS132C07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS035H03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS020A12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS028B02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS026D11+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF041O21+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS151F12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS057F07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS063G06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS074B07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS074F07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS082F01+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS084E08+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS129A11+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS120G10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS096G04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS084B10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS074B10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS041G10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS144H07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS144B12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS140G06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS112E10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS080F04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS092H08+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS156G04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS037C08+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS143D04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF045C05+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS022E09+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS127F10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS022E10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS017E04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS099G02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS168F10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS051E02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS054C11+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS044F01+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS085F07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS137H05+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS137C07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS161H10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS116H12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS016F03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS003B02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS123B03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS123E04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS157B11+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS018C08+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS121G11+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS003A01+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS162F03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS002C12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS005E08+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS027B05+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS121E02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS123G04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS152G04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS023C10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS019A09+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS001A09+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS121B01+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS123H09+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS032F06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS121F06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS114H07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS054C02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS161F05+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS019A05+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS122D05+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS162G07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS006F05+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS161F04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS125H02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS023F10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS122D10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS165G08+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS004G04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS039F10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS005G03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS150A10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS051A10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS031B12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS019F09+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS019C04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS011H02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTCGACGATGACCGCGCCGGGAACT
JMFF044A01+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF031B11+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF034B01+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF038C11+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF032A12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF032C18+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCTCGCCGGGAACT
JMFS147H07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS150G03+ AGTGTCTTGAGGTAGAATTCATTGGGGGGATTGTTCTTGACGAGGACCGCGCCGGGAACT
JMFS159D09+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS166E03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS158D10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS052A12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCNNGACGATGTCCGTGCCGGGAACT
JMFS026H02+ CGCCGGGAACT
JMFF010G06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF027G23+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF006G02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF028K21+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS023D10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS114H02+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS159E12+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS148F07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFS045E10+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTTTTGACGATGACCGCGCCTGGTACT
JMFS045D07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF019J03+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF027N22+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF047D06+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF024G20+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF031L07+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF048O04+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF032G23+ GTGATTGTTCTTGACGATGACCGCGCCGGGAACT
JMFF047A06+ GATGACCGCGCCGGGAACT
JMSF037O22+ AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
                      ____________________________________________________________
consensus AGTGTCTTGAGATAGAATTCATTGGCGTGATTGTTCTTGACGATGACCGCGCCGGGAACT
 
. : . : . : . : . : . :
JMSF033H21+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS002A08+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS151H12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS050G05+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS085G10+ CCAAGGCTTTCTCTCCATTCGAATGTAGCGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS136A06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS077D01+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS121C11+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS151C11+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS110H11+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS119F03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS075A04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS064B03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS076D02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS067D12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS102G08+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS050B08+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS130H10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS026E02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS046F06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS139E12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS145C03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS037D04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS156C06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS028H04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS079E12+ GCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS120H03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS073H06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS081F12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS114G01+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS095E05+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS137D05+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS127B04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS145B09+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS055G02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS130B02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS080B07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS118B02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS033B09+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS090D07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS066A12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS147H02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS112C02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS063C05+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS073C08+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS106H05+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS150H11+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS079B03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS098E03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS086H10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS070C10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS061G03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS086C05+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS145E08+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS167B03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS018D04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS110D01+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS153E02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS167B05+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS167A10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS008E10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS065G07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS076F02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS090D03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS061A10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS115C06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS128F03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS141A12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS142B06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS070G07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS130F01+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS041B01+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS079B06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS104A04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS067A02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS163C02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS105H04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS059A12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS128C07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS097E09+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS088C06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS112C09+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS141D12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS007D10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS059G04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS063A06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS112A12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS074G06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS102C10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS071H12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS126H05+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS140F07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS077H01+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS059C12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS111F02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS130B07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS155F07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS152C08+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS147C11+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS033D08+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS045E01+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS034D02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS147C01+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS004B09+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS004H03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFN029P23+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS040E10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS151A02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS126E05+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS167A04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS034A07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS140H06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS112D08+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS138E06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS156C11+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS134G11+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS133C04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS138D08+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS025B06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS127A07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS076A06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS094G02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS055D12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS096E09+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS076F06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS078H09+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS140H11+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS129H05+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS072G06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS090D04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS152G07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS152A10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS152A03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS012A06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS048E08+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS104D08+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS139B11+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS026D10+ CCGAGGCTTTCTCTCCATTAGAATGTAACGTAGTATGCGCGTTCGACGGGGACCAAGGAT
JMFS132C07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS035H03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS020A12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS028B02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS026D11+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF041O21+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS151F12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS057F07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS063G06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS074B07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS074F07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS082F01+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS084E08+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS129A11+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS120G10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS096G04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS084B10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS074B10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS041G10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS144H07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS144B12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS140G06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS112E10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS080F04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS092H08+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS156G04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS037C08+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS143D04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF045C05+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS022E09+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS127F10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS022E10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS017E04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS099G02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS168F10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS051E02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS054C11+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS044F01+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS085F07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS137H05+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS137C07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS161H10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS116H12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS016F03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS003B02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS123B03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS123E04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS157B11+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS018C08+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS121G11+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS003A01+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS162F03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS002C12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS005E08+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS027B05+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS121E02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS123G04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS152G04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS023C10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS019A09+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS001A09+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS121B01+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS123H09+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS032F06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS121F06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS114H07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS054C02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS161F05+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS019A05+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS122D05+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS162G07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS006F05+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS161F04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS125H02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS023F10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS122D10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS165G08+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS004G04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS039F10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS005G03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS150A10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS051A10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS031B12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS019F09+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS019C04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS011H02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF044A01+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF031B11+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF034B01+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF038C11+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF032A12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF032C18+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS147H07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS150G03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS159D09+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS166E03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS158D10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS052A12+ CCAAGGCTTTCTCTCCATTCGAATGTTACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS026H02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS036G02+ TCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF010G06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF027G23+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF006G02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF028K21+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS023D10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS114H02+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS159E12+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS148F07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS045E10+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS045D07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF019J03+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF027N22+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF047D06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF024G20+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF031L07+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF048O04+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF032G23+ CCAAGGCTTTCTCTCCATTNGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFF047A06+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMSF037O22+ CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
JMFS001H10+ T
JMFS001H09+ TGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
                      ____________________________________________________________
consensus CCAAGGCTTTCTCTCCATTCGAATGTAACGTCGTATGCGCTTTCGCCGGCGACCAAGGAT
 
. : . : . : . : . : . :
JMSF033H21+ GTTAGCTTGCCCCAGT
JMFS002A08+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS151H12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS050G05+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS085G10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS136A06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS077D01+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS121C11+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS151C11+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS110H11+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS119F03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS075A04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS064B03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS076D02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS067D12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS102G08+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS050B08+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS130H10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS026E02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS046F06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS139E12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS145C03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS037D04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS156C06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS028H04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS079E12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS120H03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS073H06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS081F12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS114G01+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS095E05+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS137D05+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS127B04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS145B09+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS055G02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS130B02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS080B07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS118B02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS033B09+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS090D07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS066A12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS147H02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS112C02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS063C05+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS073C08+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS106H05+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS150H11+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS079B03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS098E03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS086H10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS070C10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS061G03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS086C05+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS145E08+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS167B03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS018D04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS110D01+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS153E02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS167B05+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS167A10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS008E10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS065G07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS076F02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS090D03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS061A10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS115C06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS128F03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS141A12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS142B06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS070G07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS130F01+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS041B01+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS079B06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS104A04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS067A02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS163C02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS105H04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS059A12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS128C07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS097E09+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS088C06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS112C09+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS141D12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS007D10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS059G04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS063A06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS112A12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS074G06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS102C10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS071H12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS126H05+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS140F07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS077H01+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS059C12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS111F02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS130B07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS155F07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS152C08+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS147C11+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS033D08+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS045E01+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS034D02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS147C01+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS004B09+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS004H03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFN029P23+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS040E10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS151A02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS126E05+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS167A04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS034A07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS140H06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS112D08+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS138E06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS156C11+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS134G11+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS133C04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS138D08+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS025B06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS127A07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS076A06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS094G02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS055D12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS096E09+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS076F06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS078H09+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS140H11+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS129H05+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS072G06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS090D04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS152G07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS152A10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS152A03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS012A06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS048E08+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS104D08+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS139B11+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS026D10+ GTTAGCCTGCCCCAGTTGTCCAGGAAGGCTGGCGTGATTAGTTTCCCAGGATCATTATTT
JMFS132C07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS035H03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS020A12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS028B02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS026D11+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFF041O21+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS151F12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS057F07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS063G06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS074B07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS074F07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS082F01+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS084E08+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS129A11+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS120G10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS096G04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS084B10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS074B10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS041G10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS144H07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS144B12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS140G06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS112E10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS080F04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS092H08+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS156G04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS037C08+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS143D04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFF045C05+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS022E09+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS127F10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS022E10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS017E04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS099G02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS168F10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS051E02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS054C11+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS044F01+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS085F07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS137H05+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS137C07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS161H10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS116H12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS016F03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS003B02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS123B03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS123E04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS157B11+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS018C08+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS121G11+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS003A01+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS162F03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS002C12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS005E08+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS027B05+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS121E02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS123G04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS152G04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS023C10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS019A09+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS001A09+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS121B01+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS123H09+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS032F06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS121F06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS114H07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS054C02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATGATCATTT
JMFS161F05+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS019A05+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS122D05+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS162G07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS006F05+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS161F04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS125H02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS023F10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS122D10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS165G08+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS004G04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS039F10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS005G03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS150A10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS051A10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS031B12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS019F09+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS019C04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS011H02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGTTGGCTCGCTTCGTTTCCCAGGATCATCATTT
JMFF044A01+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFF031B11+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFF034B01+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFF038C11+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFF032A12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFF032C18+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS147H07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCGTGCTTAGTTTCCCAGGATCATCATTT
JMFS150G03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS159D09+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS166E03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS158D10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS052A12+ GTTAGCNNGCCCCAGTCTTCCAGGAACGCTGGCTNGCTTCGTTTCCCAGGATCATCATTT
JMFS026H02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGATGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS036G02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS158F07+ TCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS076E10+ ATCATCATTT
JMFF010G06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFF027G23+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFF006G02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATCT
JMFF028K21+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS023D10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS114H02+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS159E12+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS148F07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS045E10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGTTTCGTTTCCCAGGATCATCATTT
JMFS045D07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFF019J03+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFF027N22+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFF047D06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFF024G20+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFF031L07+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFF048O04+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFF032G23+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFF047A06+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMSF037O22+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS001H10+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
JMFS001H09+ GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
                      ____________________________________________________________
consensus GTTAGCTTGCCCCAGTCTTCCAGGAACGCTGGCTTGCTTCGTTTCCCAGGATCATCATTT
 
. : . : . : . : . : . :
JMFS002A08+ TCAGCA-CTG-ATGA
JMFS151H12+ TCAGCA-CTG-ATGA-GTTGAAA
JMFS050G05+ TCAGCA-CTG-ATGA-GTTGAAAGGA
JMFS085G10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS136A06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS077D01+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS121C11+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS151C11+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS110H11+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS119F03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS075A04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS064B03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS076D02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS067D12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS102G08+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS050B08+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS130H10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS026E02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS046F06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS139E12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS145C03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS037D04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS156C06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS028H04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS079E12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS120H03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS073H06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS081F12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS114G01+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS095E05+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS137D05+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS127B04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS145B09+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS055G02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS130B02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS080B07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS118B02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS033B09+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS090D07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS066A12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS147H02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS112C02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS063C05+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS073C08+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS106H05+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS150H11+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS079B03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS098E03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS086H10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS070C10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS061G03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS086C05+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS145E08+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS167B03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS018D04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS110D01+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS153E02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS167B05+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS167A10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS008E10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS065G07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS076F02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS090D03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS061A10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS115C06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS128F03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS141A12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS142B06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS070G07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS130F01+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS041B01+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS079B06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS104A04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS067A02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS163C02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS105H04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS059A12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS128C07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS097E09+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS088C06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS112C09+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS141D12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS007D10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS059G04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS063A06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS112A12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS074G06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS102C10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS071H12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS126H05+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS140F07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS077H01+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS059C12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS111F02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS130B07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS155F07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS152C08+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS147C11+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS033D08+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS045E01+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS034D02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS147C01+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS004B09+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS004H03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFN029P23+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS040E10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS151A02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS126E05+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS167A04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS034A07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS140H06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS112D08+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS138E06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS156C11+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS134G11+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS133C04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS138D08+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS025B06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS127A07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS076A06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS094G02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS055D12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS096E09+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS076F06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS078H09+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS140H11+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS129H05+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS072G06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS090D04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS152G07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS152A10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS152A03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS012A06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS048E08+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS104D08+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS139B11+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS026D10+ TCAGCA-GTG-ATGA-GTTAAAAAGAGACCTTATGACCAAGAAAGTCT-TGAATTTTATC
JMFS132C07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS035H03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS020A12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS028B02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS026D11+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF041O21+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS151F12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS057F07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS063G06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS074B07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS074F07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS082F01+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS084E08+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS129A11+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS120G10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS096G04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS084B10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS074B10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS041G10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS144H07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS144B12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS140G06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS112E10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS080F04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS092H08+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS156G04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS037C08+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS143D04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF045C05+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS022E09+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS127F10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS022E10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS017E04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS099G02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS168F10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS051E02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS054C11+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS044F01+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS085F07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS137H05+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS137C07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS161H10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS116H12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS016F03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS003B02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS123B03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS123E04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS157B11+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS018C08+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS121G11+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS003A01+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS162F03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS002C12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS005E08+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS027B05+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS121E02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS123G04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS152G04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS023C10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS019A09+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS001A09+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS121B01+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS123H09+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS032F06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS121F06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS114H07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS054C02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS161F05+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS019A05+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS122D05+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS162G07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS006F05+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS161F04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS125H02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS023F10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS122D10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS165G08+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS004G04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS039F10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS005G03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS150A10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS051A10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS031B12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS019F09+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS019C04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS011H02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF044A01+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF031B11+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF034B01+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF038C11+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF032A12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF032C18+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS147H07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTGTGACCAACAAAGTCT-TGAATTTTATC
JMFS150G03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS159D09+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGCCT-TGAATTTTATC
JMFS166E03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS158D10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGCCCTTTATC
JMFS052A12+ TCAGCA-CTG-ATGA-GTNGAAAGGAGTCCNTNTGACCAACATAGTCT-TGAATTNNATC
JMFS026H02+ TCAGCA-TTG-ATGA-GTTGAAAGGAGCCCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS036G02+ TCATCAGCTGAATGATGTTGAAAGGAGACTTTTTGACCAACAAAGTCT-TGAATTTTATC
JMFS158F07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCTCTGAATTTTATC
JMFS076E10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF010G06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF027G23+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF006G02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF028K21+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS023D10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS114H02+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS159E12+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS148F07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS045E10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS045D07+ TC
JMFF019J03+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF027N22+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF047D06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF024G20+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF031L07+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF048O04+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF032G23+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFF047A06+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMSF037O22+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS001H10+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
JMFS001H09+ TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
                      ____________________________________________________________
consensus TCAGCA-CTG-ATGA-GTTGAAAGGAGACCTTCTGACCAACAAAGTCT-TGAATTTTATC
 
. : . : . : . : . : . :
JMFS085G10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAA
JMFS136A06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAA
JMFS077D01+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACC
JMFS121C11+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS151C11+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS110H11+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS119F03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS075A04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS064B03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS076D02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS067D12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS102G08+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS050B08+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS130H10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS026E02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS046F06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS139E12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS145C03+ AACGATAGAAGCACCTACGTCTGTCAAGTGTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS037D04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS156C06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS028H04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS079E12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS120H03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS073H06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS081F12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS114G01+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS095E05+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS137D05+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS127B04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS145B09+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS055G02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS130B02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS080B07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS118B02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS033B09+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS090D07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS066A12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS147H02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS112C02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS063C05+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS073C08+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS106H05+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS150H11+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS004C03+ AAGAAGTTGTTGTTCATCAACACCACCCT
JMFS079B03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS098E03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS086H10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS070C10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS061G03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS086C05+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS145E08+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS167B03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS018D04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS110D01+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS153E02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS167B05+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS167A10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS008E10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS065G07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS076F02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS090D03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS061A10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS115C06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS128F03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS141A12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS142B06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS070G07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS130F01+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS041B01+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS079B06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS104A04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS067A02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS163C02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS105H04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS059A12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS128C07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS097E09+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS088C06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS112C09+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS141D12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS007D10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS059G04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS063A06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS112A12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS074G06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS102C10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS071H12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS126H05+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS140F07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS077H01+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS059C12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS111F02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS130B07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS155F07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS152C08+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS147C11+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS033D08+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS045E01+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS034D02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS147C01+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS004B09+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGCTCTTCTTCATCAACACCACCCT
JMFS004H03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFN029P23+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS040E10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS151A02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS126E05+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS167A04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS034A07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS140H06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS112D08+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS138E06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS156C11+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS134G11+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS133C04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS138D08+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS025B06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS127A07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS076A06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS094G02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS055D12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS096E09+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS076F06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS078H09+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS140H11+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS129H05+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS072G06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS090D04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS152G07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS152A10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS152A03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS012A06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS048E08+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS104D08+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS139B11+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS026D10+ ACCAATAGAAGCACCCATGTCTGTCAAGTATAAAAAGTTTTTTTTCATCAACACCCCCCG
JMFS132C07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS035H03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS020A12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS028B02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS026D11+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF041O21+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS151F12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS057F07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS063G06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS074B07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS074F07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS082F01+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS084E08+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS129A11+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS120G10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS096G04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS084B10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS074B10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS041G10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS144H07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS144B12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS140G06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS112E10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS080F04+ AACGATAGAAGCACCTACGTCTGTGAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS092H08+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS156G04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS037C08+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS143D04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF045C05+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS022E09+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS127F10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS022E10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS017E04+ AACGATAGAAGCAC-TACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS099G02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS168F10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS051E02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS054C11+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS044F01+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS085F07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS137H05+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS137C07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS161H10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS116H12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS016F03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS003B02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS123B03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS123E04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS157B11+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS018C08+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS121G11+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS003A01+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS162F03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS002C12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS005E08+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS027B05+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS121E02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS123G04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS152G04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS023C10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS019A09+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS001A09+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS121B01+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS123H09+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS032F06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS121F06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS114H07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS054C02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS161F05+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS019A05+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS122D05+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS162G07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS006F05+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS161F04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS125H02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS023F10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS122D10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS165G08+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS004G04+ AACGATACAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS039F10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS005G03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAACAAGTTCTTCTTCATCAACACCACCCT
JMFS150A10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS051A10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS031B12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS019F09+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS019C04+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS011H02+ AACGATACAAGCACATACGTCTGTCAAGTCTAAGAAGTTGTTCTTCATCAACACCACCCT
JMFF044A01+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF031B11+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF034B01+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF038C11+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF032A12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF032C18+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS147H07+ AACGATAGAAGCACCTACGTCTGTCAAGTATAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS150G03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS159D09+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS166E03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS158D10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS052A12+ AACGATATTAGCACCTTTGTCTGTCAAGTCTAAGAAGTTTTTNNNCATCAACACCACCCT
JMFS026H02+ ATCGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS036G02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS158F07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTTTTCTTCATCAACACCACCCT
JMFS076E10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF010G06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF027G23+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS063D06+ ACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF006G02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF028K21+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS023D10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS114H02+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS159E12+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS148F07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS045E10+ TACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTNTTCATCAACACCACC
JMFF019J03+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF027N22+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF047D06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF024G20+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF031L07+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF048O04+ AATGATAGTAGCACCTACGTCTGTCAAGTCTAAGTAGTTCTTCTTCATCAACACCACCCT
JMFF032G23+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF047A06+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFF030M16+ GTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMSF037O22+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS001H10+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
JMFS001H09+ AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
                      ____________________________________________________________
consensus AACGATAGAAGCACCTACGTCTGTCAAGTCTAAGAAGTTCTTCTTCATCAACACCACCCT
 
. : . : . : . : . : . :
JMFS121C11+ GCCTTTA
JMFS151C11+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACC
JMFS110H11+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS119F03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS075A04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS064B03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS076D02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS067D12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS102G08+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS050B08+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS130H10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS026E02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS046F06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAAT
JMFS139E12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS145C03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS037D04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS156C06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS028H04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS079E12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS120H03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS073H06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS081F12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS114G01+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS095E05+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS137D05+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS127B04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS145B09+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS055G02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS130B02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS080B07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS118B02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS033B09+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS090D07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS066A12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS147H02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS112C02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS063C05+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS073C08+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS106H05+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS150H11+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS004C03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS079B03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS098E03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS086H10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS070C10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS061G03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS086C05+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS145E08+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS167B03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS018D04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS110D01+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS153E02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS167B05+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS167A10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS008E10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS065G07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS076F02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS090D03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS061A10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS115C06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS128F03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS141A12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS142B06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS070G07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS130F01+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS041B01+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS079B06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS104A04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS067A02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS163C02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS105H04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS059A12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS128C07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS097E09+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS088C06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS112C09+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS141D12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS007D10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS059G04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS063A06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS112A12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS074G06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS102C10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS071H12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS126H05+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS140F07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS077H01+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS059C12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS111F02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS130B07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS155F07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS152C08+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS147C11+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS033D08+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS045E01+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS034D02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS147C01+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS004B09+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS004H03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFN029P23+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS040E10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS151A02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS126E05+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS167A04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS034A07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS140H06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS112D08+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS138E06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS156C11+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS134G11+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS133C04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS138D08+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS025B06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS127A07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS076A06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS094G02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS055D12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS096E09+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS076F06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS078H09+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS140H11+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS129H05+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS072G06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS090D04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS152G07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGAGATGGCACCCGCAATCTTGC
JMFS152A10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS152A03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS012A06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS048E08+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS104D08+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS139B11+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS026D10+ GCAGTTAATCTAGTTCG-GTTCATCAGCATGTTTTGCAGAGATGGCACCCGCAATCTTGC
JMFS132C07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS035H03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS020A12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS028B02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS026D11+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF041O21+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS151F12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS057F07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS063G06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS074B07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS074F07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS082F01+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS084E08+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS129A11+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS120G10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS096G04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS084B10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS074B10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS041G10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS144H07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS144B12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS140G06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS112E10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS080F04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS092H08+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS156G04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS037C08+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS143D04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF045C05+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS022E09+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS127F10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS022E10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS017E04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS099G02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS168F10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS051E02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS054C11+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS044F01+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS085F07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS137H05+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS137C07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS161H10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS116H12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS016F03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS003B02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS123B03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS123E04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS157B11+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS018C08+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS121G11+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS003A01+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS162F03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS002C12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS005E08+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS027B05+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS121E02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS123G04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS152G04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS023C10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS019A09+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS001A09+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS121B01+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS123H09+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS032F06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS121F06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS114H07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS054C02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS161F05+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS019A05+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS122D05+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS162G07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS006F05+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS161F04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS125H02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS023F10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS122D10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS165G08+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS004G04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS039F10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS005G03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS150A10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS051A10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATG-TTTGCAGCGATGGCACCCGCAATCTTGC
JMFS031B12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS019F09+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS019C04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS011H02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTT
JMFF044A01+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF031B11+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF034B01+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF038C11+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF032A12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF032C18+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS147H07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS150G03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS159D09+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS166E03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS158D10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS052A12+ GCCTTTAATCTTTTTCG-GTTCANCAGCATGT
JMFS026H02+ GCCTTTAATCTTTTTCGCGTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTCGC
JMFS036G02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS158F07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS076E10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF010G06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF027G23+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS063D06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF006G02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF028K21+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS023D10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS114H02+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS159E12+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS148F07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF019J03+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF027N22+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF047D06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF024G20+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF031L07+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF048O04+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF032G23+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF047A06+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFF030M16+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMSF037O22+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCAGCAATCTTGC
JMFS001H10+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS001H09+ GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
JMFS144C03+ TTTGCAGCGATGGCACCCGCAATCTTGC
                      ____________________________________________________________
consensus GCCTTTAATCTTTTTCG-GTTCATCAGCATGTTTTGCAGCGATGGCACCCGCAATCTTGC
 
. : . : . : . : . : . :
JMFS110H11+ CCAGA-ATCATTGTAA
JMFS119F03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGT
JMFS075A04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAG
JMFS064B03+ CCAGA-ATCATT
JMFS076D02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTC
JMFS067D12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAG
JMFS102G08+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGT
JMFS050B08+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGT
JMFS130H10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGT
JMFS026E02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTC
JMFS139E12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCT
JMFS145C03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS037D04+ CCAGA-ATC
JMFS156C06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCT
JMFS028H04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS079E12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTG
JMFS120H03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS073H06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS081F12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS114G01+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS095E05+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTA
JMFS137D05+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS127B04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTA
JMFS145B09+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS055G02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTT
JMFS130B02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCT
JMFS080B07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGT
JMFS118B02+ CCAGA-ATCATTGTAACAAGCTT-AC
JMFS033B09+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTA
JMFS090D07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAA
JMFS066A12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAA
JMFS147H02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTT
JMFS112C02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAA
JMFS063C05+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAA
JMFS073C08+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAA
JMFS106H05+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAA
JMFS150H11+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGT
JMFS004C03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTC
JMFS079B03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCT
JMFS098E03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATA
JMFS086H10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGT
JMFS070C10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATA
JMFS061G03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGT
JMFS086C05+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS145E08+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS167B03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTT
JMFS018D04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATA
JMFS110D01+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTAT
JMFS153E02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS167B05+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTT
JMFS167A10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS008E10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTG
JMFS065G07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTG
JMFS076F02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTG
JMFS090D03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTG
JMFS061A10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS115C06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS128F03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS141A12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS142B06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS070G07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTT
JMFS130F01+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTT
JMFS041B01+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS079B06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCT
JMFS104A04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTC
JMFS067A02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGT
JMFS163C02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAG
JMFS105H04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGT
JMFS059A12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAA
JMFS128C07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS097E09+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS088C06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS112C09+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS141D12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS007D10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS059G04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS063A06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS112A12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAAT
JMFS074G06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAAT
JMFS102C10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAAT
JMFS071H12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS126H05+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS140F07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS077H01+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAAT
JMFS059C12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATAGATTAATG
JMFS111F02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS130B07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAAT
JMFS155F07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTA
JMFS152C08+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAAT
JMFS147C11+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAG
JMFS033D08+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTT
JMFS045E01+ CCAGA-ATCATTG
JMFS034D02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAG
JMFS147C01+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGA
JMFS004B09+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS004H03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFN029P23+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAG
JMFS040E10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAAT
JMFS151A02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS126E05+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS167A04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS034A07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS140H06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS112D08+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGA
JMFS138E06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGA
JMFS156C11+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS134G11+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS133C04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS138D08+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS025B06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAAT
JMFS127A07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAAT
JMFS076A06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS094G02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAA
JMFS055D12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGA
JMFS096E09+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS076F06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS078H09+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS140H11+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS129H05+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS072G06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS090D04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS152G07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAA
JMFS152A10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATA
JMFS152A03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS012A06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTAT
JMFS048E08+ CCAGA-ATCATTG
JMFS104D08+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS139B11+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS026D10+ CCAGA-ATCATTGTATCAAGCTTAATTTAGTTGTTTGGATATATTAATAAAGATAGAA
JMFS132C07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS035H03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAA
JMFS020A12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS028B02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS026D11+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFF041O21+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS151F12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS057F07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS063G06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS074B07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS074F07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS082F01+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS084E08+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS129A11+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS120G10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAA
JMFS096G04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAA
JMFS084B10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGA
JMFS074B10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS041G10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAAT
JMFS144H07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAA
JMFS144B12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS140G06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS112E10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS080F04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS092H08+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS156G04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAA
JMFS037C08+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAAT
JMFS143D04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAG
JMFF045C05+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS022E09+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS127F10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS022E10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS017E04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS099G02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTA
JMFS168F10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS051E02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS054C11+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTG
JMFS044F01+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGT
JMFS085F07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAA
JMFS137H05+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTT
JMFS137C07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS161H10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS116H12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS016F03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTG
JMFS003B02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS123B03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS123E04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS157B11+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAA
JMFS018C08+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAA
JMFS121G11+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAA
JMFS003A01+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS162F03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS002C12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGA
JMFS005E08+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS027B05+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS121E02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS123G04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS152G04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS023C10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS019A09+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGA
JMFS001A09+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAA
JMFS121B01+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAAT
JMFS123H09+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAAT
JMFS032F06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS121F06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAA
JMFS114H07+ CCAGA-ATCATTGTAACAAGCTT-ACT
JMFS054C02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAAT
JMFS161F05+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTA
JMFS019A05+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTA
JMFS122D05+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS162G07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS006F05+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS161F04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS125H02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTA
JMFS023F10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGT
JMFS122D10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTT
JMFS165G08+ CCAGA-ATCATTGTAACAAGCTT-AC
JMFS004G04+ CCAGA-ATCATTGTAACAAG
JMFS039F10+ CCAGA-ATCATTGTAACAAGCTT-AC
JMFS005G03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTAT
JMFS150A10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGT
JMFS031B12+ CCAGA-ATCATTGTAACAA
JMFS019F09+ CCAGA-ATC
JMFS019C04+ CCAGA-ATC
JMFF044A01+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFF031B11+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFF034B01+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFF038C11+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFF032A12+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFF032C18+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS147H07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS150G03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS159D09+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS166E03+ CCAGA-ATCATT
JMFS158D10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAA
JMFS026H02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTC
JMFS036G02+ CCAGAGATCATTGTAACAAGCTA-ACTTAGTTCTTTGTATATATTAATGAAG
JMFS158F07+ CCAGA-ATCATTGTAACAAGCTT-CCTTAGTTCTTTGTATATATTAATGAAGAGA
JMFS076E10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAA
JMFF010G06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFF027G23+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS063D06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGA
JMFF006G02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFF028K21+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS023D10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS114H02+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGA
JMFS159E12+ CCAGA-ATCATTGTAACAAGCCT-ACTTAGTTCTTTGTATATATTAATGAA
JMFS148F07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAA
JMFF019J03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFF027N22+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFF047D06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFF024G20+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFF031L07+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFF048O04+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFF032G23+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFF047A06+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFF030M16+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMSF037O22+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS001H10+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS001H09+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
JMFS144C03+ CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
                      ____________________________________________________________
consensus CCAGA-ATCATTGTAACAAGCTT-ACTTAGTTCTTTGTATATATTAATGAAGAGAGAATA
 
. : . : . : . : . : . :
JMFS104D08+ AA
JMFS139B11+ AAA
JMFS132C07+ AAA
JMFS020A12+ AAA
JMFS028B02+ AAA
JMFS026D11+ AAA
JMFF041O21+ AAATGC
JMFS151F12+ AAA
JMFS057F07+ AAA
JMFS063G06+ AAA
JMFS074B07+ AAA
JMFS074F07+ AAA
JMFS082F01+ AAA
JMFS084E08+ AAA
JMFS129A11+ AAA
JMFS074B10+ AA
JMFS144B12+ AAATGCTT
JMFS140G06+ AAA
JMFS112E10+ AAA
JMFS080F04+ AAAT
JMFS092H08+ AA
JMFF045C05+ AAATGCTT
JMFS127F10+ AAA
JMFS168F10+ AAA
JMFS123E04+ AAA
JMFF044A01+ AAATGCTT
JMFF031B11+ AAATGCTTGCAGATGT
JMFF034B01+ AAATGCTTGCAAATGT
JMFF038C11+ AAATGCTT
JMFF032A12+ AAATGCTT
JMFF032C18+ AAATGCTTGCAAATGT
JMFS147H07+ AAA
JMFS150G03+ AAA
JMFF010G06+ AAATGCTT
JMFF027G23+ AAATGCTT
JMFF006G02+ AAATGCTTGCAAATGT
JMFF028K21+ AAATGCTTGCAGATGT
JMFS023D10+ AAA
JMFF019J03+ AAATGCTTGCAGATGT
JMFF027N22+ AAATGCTTGCAGATGT
JMFF047D06+ AAATGCTTGCAGATGT
JMFF024G20+ AAATGCTTGCAGATGT
JMFF031L07+ AAATGCTTGCAGATGT
JMFF048O04+ AAATGCTTGCAGATGT
JMFF032G23+ AAATGCTTGCAGATGT
JMFF047A06+ AAATGCTTGCAGATGT
JMFF030M16+ AAATGCTTGCAGATGT
JMSF037O22+ AAATGCTTGCAGATGT
JMFS001H10+ AAATGCTTGCAGATGTGATTGTCTAGTCCCAAGCACTCGTATTTATATAAGATGAGGCGA
JMFS001H09+ AAATGCTTGCAGATGTGATTGTCTAGTCCCAAGCACTCGTATTTATATAAGATGAGGCGA
JMFS144C03+ AAATGCTTGCAGATGTGATTGTCTAGTCCCAAGCACTCGTATTTATATAAGATGAGGCGA
                      ____________________________________________________________
consensus AAATGCTTGCAGATGTGATTGTCTAGTCCCAAGCACTCGTATTTATATAAGATGAGGCGA
 
. : . : . : . : . : . :
JMFS001H10+ GTTTGATCAACATAGGTGGGCAGGCGTCCTC
JMFS001H09+ GTTTGATCAACATAGGTGGGCAGGCGTCCTCTTCAATTCTGATCCACATTTAATTTAGGA
JMFS144C03+ GTTTGATCAACATAGGTGGGCAGGCGTCCTCTTCAATTCTGATCCACATTTAATTTAGGA
                      ____________________________________________________________
consensus GTTTGATCAACATAGGTGGGCAGGCGTCCTCTTCAATTCTGATCCACATTTAATTTAGGA
 
. : . : . : . : . : . :
JMFS001H09+ GTAAAAATGTTATTTAAAAATGAATAAATTAAAATTGAAAAATAGCTATCCCTAAGAATT
JMFS144C03+ GTAAAAATGTTATTTAAAAATGAATAAATTAAAATTGAAAAATAGCTATCCCTAAGAATT
                      ____________________________________________________________
consensus GTAAAAATGTTATTTAAAAATGAATAAATTAAAATTGAAAAATAGCTATCCCTAAGAATT
 
. : . : . : . : . : . :
JMFS001H09+ TAGGAATACCAAAGCCAAATCCCATATATTTGGGATGGTTATTCCTTTTTTGCAAGGAGA
JMFS144C03+ TAGGAATACCAAAGCCAAATCCCATATATTTGGGATGGTTATTCCTTTTTTGCAAGGAGA
                      ____________________________________________________________
consensus TAGGAATACCAAAGCCAAATCCCATATATTTGGGATGGTTATTCCTTTTTTGCAAGGAGA
 
. : . : . : . : . : . :
JMFS001H09+ ATAACCCATTATTCTATAAGATATTTTCTTCTTCTCTGGGCACCCTACA
JMFS144C03+ ATAACCCATTATTCTATAAGATATTTTCTTCTTCTCTGGGCACCCTACACCCCGGTCCGA
                      ____________________________________________________________
consensus ATAACCCATTATTCTATAAGATATTTTCTTCTTCTCTGGGCACCCTACACCCCGGTCCGA
 
. : . : . : . : . : . :
JMFS144C03+ CAGAGCATTTTAGAAGATGTAAATCACATATAAGGGATCTGTTCACTTTGGGCATAATCT
                      ____________________________________________________________
consensus CAGAGCATTTTAGAAGATGTAAATCACATATAAGGGATCTGTTCACTTTGGGCATAATCT
 
. : . : . : . : . : . :
JMFS144C03+ AACCTCGGTCTGACAGAGCATTTTAGAAAAATGAAAACGAAAAAAATGGTGATCACCATG
                      ____________________________________________________________
consensus AACCTCGGTCTGACAGAGCATTTTAGAAAAATGAAAACGAAAAAAATGGTGATCACCATG
 
. : . : . : . : . : . :
JMFS144C03+ GATATATGACATTCCTGCTCACAACGTATTGTAAACTATGTTGTTTCCTTGAGTGAATGT
                      ____________________________________________________________
consensus GATATATGACATTCCTGCTCACAACGTATTGTAAACTATGTTGTTTCCTTGAGTGAATGT
 
. : . : . : . : . : . :
JMFS144C03+ ATCGTTTTTTAACTAGAGTGCAATAGCTAATGCCATACAGAAGATGAATAATGAAGTAAA
                      ____________________________________________________________
consensus ATCGTTTTTTAACTAGAGTGCAATAGCTAATGCCATACAGAAGATGAATAATGAAGTAAA