Previous Contig 004072:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS019F01Sequence557004072 (7)
JMFS023D07Sequence611004072 (7)
JMFS100H06Sequence609004072 (7)
JMFS130D04Sequence562004072 (7)
JMFS131C10Sequence618004072 (7)
JMFS144A11Sequence616004072 (7)
JMFS153F05Sequence616004072 (7)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS130D04+ CTCTGCTTTCTCAACACACACTCAGAGGGGGAAGTT
                      ____________________________________________________________
consensus CTCTGCTTTCTCAACACACACTCAGAGGGGGAAGTT
 
. : . : . : . : . : . :
JMFS130D04+ TGGACCTGGGAAGTCGCCATTTTTGTTCTCCTCAACAAATTTCTACGCAGAAAACAAGAT
JMFS131C10+ CAAATTTCTACGCAGAAAACAAGAT
JMFS100H06+ ACGCAGAAAACAAGAT
JMFS153F05+ ACGCAGAAAACAAGAT
JMFS023D07+ GCAGAAAACAAGAT
JMFS144A11+ ACGCAGAAAACAAGAT
                      ____________________________________________________________
consensus TGGACCTGGGAAGTCGCCATTTTTGTTCTCCTCAACAAATTTCTACGCAGAAAACAAGAT
 
. : . : . : . : . : . :
JMFS130D04+ TATCAACAATGGTGTACGGCAGCCTCAAGATTTCAAACAGTTAATGCAGAGACTACAAAC
JMFS131C10+ TATCAACAATGGTGTACGGCAGCCTCAAGATTTCAAACAGTTAATGCAGAGACTACAAAC
JMFS019F01+ AAGATTTCAAACAGTTAATGCAGAGACTACAAAC
JMFS100H06+ TATCAACAATGGTGTACGGCAGCCTCAAGATTTCAAACAGTTAATGCAGAGACTACAAAC
JMFS153F05+ TATCAACAATGGTGTACGGCAGCCTCAAGATTTCAAACAGTTAATGCAGAGACTACAAAC
JMFS023D07+ TATCAACAATGGTGTACGGCAGCCTCAAGATTTCAAACAGTTAATGCAGAGACTACAAAC
JMFS144A11+ TATCAACAATGGGGTACGGCAGCCTCAAGATTTCAAACAGTTAATGCAGAGACTACAAAC
                      ____________________________________________________________
consensus TATCAACAATGGTGTACGGCAGCCTCAAGATTTCAAACAGTTAATGCAGAGACTACAAAC
 
. : . : . : . : . : . :
JMFS130D04+ ATCCATCCTGAAAACCAAAGCTTCTTCTTCTCAGGTAAAAAAGGAAGGAAAATTTATCCA
JMFS131C10+ ATCCATCCTGAAAACCAAAGCTTCTTCTTCTCAGGTAAAAAAGGAAGGAAAATTTATCCA
JMFS019F01+ ATCCATCCTGAAAACCANAGCTTCTTCTTCTCAGGTAAAAAAGGAAGGAAAATTTATCCA
JMFS100H06+ ATCCATCCTGAAAACCAAAGCTTCTTCTTCTCAGGTAAAAAAGGAAGGAAAATTTATCCA
JMFS153F05+ ATCCATCCTGAAAACCAAAGCTTCTTCTTCTCAGGTAAAAAAGGAAGGAAAATTTATCCA
JMFS023D07+ ATCCATCCTGAAAACCAAAGCTTCTTCTTCTCAGGTAAAAAAGGAAGGAAAATTTATCCA
JMFS144A11+ ATCCATCCTGAAAACCAAAGCTTCTTCTTCTCAGGTAAAAAAGGAAGGAAAATTTATCCA
                      ____________________________________________________________
consensus ATCCATCCTGAAAACCAAAGCTTCTTCTTCTCAGGTAAAAAAGGAAGGAAAATTTATCCA
 
. : . : . : . : . : . :
JMFS130D04+ TTCTTCTCTCCCCCTCCAGAAACCCGAAATTCGAACGAGAAACAGAGATTTCCGTGTTTC
JMFS131C10+ TTCTTCTCTCCCCCTCCAGAAACCCGAAATTCGAACGAGAAACAGAGATTTCCGTGTTTC
JMFS019F01+ TTCTTCTCTCCCCCTCCAGAAACCCGAAATTCGAACGAGAAACAGAGATTTCCGTGTTTC
JMFS100H06+ TTCTTCTCTCCCCCTCCAGAAACCCGAAATTCGAACGAGAAACAGAGATTTCCGTGTTTC
JMFS153F05+ TTCTTCTCTCCCCCTCCAGAAACCCGAAATTCGAACGAGAAACAGAGATTTCCGTGTTTC
JMFS023D07+ TTCTTCTCTCCCCCTCCAGAAACCCGAAATTCGAACGAGAAACAGAGATTTCCGTGTTTC
JMFS144A11+ TTCTTCTCTCCCCCTCCAGAAACCCGAAATTCGAACGAGAAACAGAGATTTCCGTGTTTC
                      ____________________________________________________________
consensus TTCTTCTCTCCCCCTCCAGAAACCCGAAATTCGAACGAGAAACAGAGATTTCCGTGTTTC
 
. : . : . : . : . : . :
JMFS130D04+ TTTTCTTTATTTCTTGGAGCATTCATCAAATGTTCCCAGCTCAATTAGCTCCAGCACTTG
JMFS131C10+ TTTTCTTTATTTCTTGGAGCATTCATCAAATGTTCCCAGCTCAATTAGCTCCAGCACTTG
JMFS019F01+ TTTTCTTTATTTCTTGGAGCATTCATCAAATGTTCCCAGCTCAATTAGCTCCAGCACTTG
JMFS100H06+ TTTTCTTTATTTCTTGGAGCATTCATCAAATGTTCCCAGCTCAATTAGCTCCAGCACTTG
JMFS153F05+ TTTTCTTTATTTCTTGGAGCATTCATCAAATGTTCCCAGCTCAATTAGCTCCAGCACTTG
JMFS023D07+ TTTTCTTTATTTCTTGGAGGATTCATCAAATGTTCCCAGCTCAATTAGCTCCAGCACTTG
JMFS144A11+ TTTTCTTTATTTCTTGGAGCATTCATCAAATGTTCCCAGCTCAATTAGCTCCAGCACTTG
                      ____________________________________________________________
consensus TTTTCTTTATTTCTTGGAGCATTCATCAAATGTTCCCAGCTCAATTAGCTCCAGCACTTG
 
. : . : . : . : . : . :
JMFS130D04+ CGCCGCAGCATGTTTAAGGATTTCCCCCATTACCATTCCCTGATTTGACCATTTTCTGAA
JMFS131C10+ CGCCGCAGCATGTTTAAGGATTTCCCCCATTACCATTCCCTGATTTGACCATTTTCTGAA
JMFS019F01+ CGCCGCAGCATGTTTAAGGATTTCCCCCATTACCATTCCCTGATTTGACCATTTTCTGAA
JMFS100H06+ CGCCGCAGCATGTTTAAGGATTTCCCCCATTACCATTCCCTGATTTGACCATTTTCTGAA
JMFS153F05+ CGCCGCAGCATGTTTAAGGATTTCCCCCATTACCATTCCCTGATTTGACCATTTTCTGAA
JMFS023D07+ CGCCGCAGCATGTTTAAGGATTTCCCCCATTACCATTCCCTGATTTGACCATTTTCTGAA
JMFS144A11+ CGCCGCAGCATGTTTAAGGATTTCCCCCATTACCATTCCCTGATTTGACCATTTTCTGAA
                      ____________________________________________________________
consensus CGCCGCAGCATGTTTAAGGATTTCCCCCATTACCATTCCCTGATTTGACCATTTTCTGAA
 
. : . : . : . : . : . :
JMFS130D04+ TTTTCCAAGGAGAGAGAAAGAGAGAGAGGGAAACCAAACAGAAAATGTCAAAATTGAAAA
JMFS131C10+ TTTTCCAAGGAGAGAGAAAGAGAGAGAGGGAAACCAAACAGAAAATGTCAAAATTGAAAA
JMFS019F01+ TTTTCCAAGGAGAGAGAAAGAGAGAGAGGGAAACCAAACAGAAAATGTCAAAATTGAAAA
JMFS100H06+ TTTTCCAAGGAGAGAGAAAGAGAGAGAGGGAAACCAAACAGAAAATGTCAAAATTGAAAA
JMFS153F05+ TTTTCCAAGGAGAGAGAAAGAGAGAGAGGGAAACCAAACAGAAAATGTCAAAATTGAAAA
JMFS023D07+ TTTTCCAAGGAGAGAGAAAGAGAGAGAGGGAAACCAAACAGAAAATGTCAAAATTGAAAA
JMFS144A11+ TTTTCCAAGGAGAGAGAAAGAGAGAGAGGGAAACCAAACAGAAAATGTCAAAATTGAAAA
                      ____________________________________________________________
consensus TTTTCCAAGGAGAGAGAAAGAGAGAGAGGGAAACCAAACAGAAAATGTCAAAATTGAAAA
 
. : . : . : . : . : . :
JMFS130D04+ CAAATGAAAGAAAGAGAAGGCTGCATATTGGACAGAAAAGTGCGGTTGTGGCGGGAATTC
JMFS131C10+ CAAATGAAAGAAAGAGAAGGCTGCATATTGGACAGAAAAGTGCGGTTGTGGCGGGAATTC
JMFS019F01+ CAAATGAAAGAAAGAGAAGGCTGCATATTGGACAGAAAAGTGCGGTTGTGGCGGGAATTC
JMFS100H06+ CAAATGAAAGAAAGAGAAGGCTGCATATTGGACAGAAAAGTGCGGTTGTGGCGGGAATTC
JMFS153F05+ CAAATGAAAGAAAGAGAAGGCTGCATATTGGACAGAAAAGTGCGGTTGTGGCGGGAATTC
JMFS023D07+ CAAATGAAAGAAAGAGAAGGCTGCATATTGGACAGAAAAGTGCGGTTGTGGCGGGAATTC
JMFS144A11+ CAAATGAAAGAAAGAGAAGGCTGCATATTGGACAGAAAAGTGCGGTTGTGGCGGGAATTC
                      ____________________________________________________________
consensus CAAATGAAAGAAAGAGAAGGCTGCATATTGGACAGAAAAGTGCGGTTGTGGCGGGAATTC
 
. : . : . : . : . : . :
JMFS130D04+ ACAGAAGACTCCATGGGTATAGCCCAGAAAACGAACACAAACAAAC
JMFS131C10+ ACAGAAGACTCCATGGGTATAGCCCAGAAAACGAACACAAACAAACAAAAAATCAAAGAG
JMFS019F01+ ACAGAAGACTCCATGGGTATAGCCCAGAAAACGAACACAAACAAACAAAAAATCAAAGAG
JMFS100H06+ ACAGAAGACTCCATGGGTATAGCCCAGAAAACGAACACAAACAAACAAAAAATCAAAGAG
JMFS153F05+ ACAGAAGACTCCATGGGTATAGCCCAGAAAACGAACACAAACAAACAAAAAATCAAAGAG
JMFS023D07+ ACAGAAGACTCCATGGGTATAGCCCAGAAAACGAACACAAACAAACAAAAAATCAAAGAG
JMFS144A11+ ACAGAAGACTCCATGGGTATAGCCCAGAAAACGAACACAAACAAACAAAAAATCAAAGAG
                      ____________________________________________________________
consensus ACAGAAGACTCCATGGGTATAGCCCAGAAAACGAACACAAACAAACAAAAAATCAAAGAG
 
. : . : . : . : . : . :
JMFS131C10+ CTTTCCGACGAAAGATCTCAGGGAAGACGAAGGCAAAGGACAATGGGGAAATTGCTGCGT
JMFS019F01+ CTTTCCGACGAAAGATCTCAGGGAAGACGAAGGCAAAGGACAATGGGGAAATTGCTGCGT
JMFS100H06+ CTTTCCGACGAAAGATCTCAGGGAAGACGAAGGCAAAGGACAATGGGGAAATTGCTGCGT
JMFS153F05+ CTTTCCGACGAAAGATCTCAGGGAAGACGAAGGCAAAGGACAATGGGGAAATTGCTGCGT
JMFS023D07+ CTTTCCGACGAAAGATCTCAGGGAAGACGAAGGCAAAGGACAATGGGGAAATTGCTGCGT
JMFS144A11+ CTTTCCGACGAAAGATCTCAGGGAAGACGAAGGCAAAGGACAATGGGGAAATTGCTGCGT
                      ____________________________________________________________
consensus CTTTCCGACGAAAGATCTCAGGGAAGACGAAGGCAAAGGACAATGGGGAAATTGCTGCGT
 
. : . : . : . : . : . :
JMFS131C10+ TTAAGTCCAAAAATGTTAGGCATGCGCCGGGGTGGGTGGGTGGGTAGATCATA
JMFS019F01+ TTAAGTCCAAAAATGTTAGGCATGCGCCGGGGTGGGTGGGTGG
JMFS100H06+ TTAAGTCCAAAAATGTTAGGCATGCGCCGGGGTGGGTGGGTGGGTAGATCATA
JMFS153F05+ TTAAGTCCAAAAATGTTAGGCATGCGCCGGGGTGGGTGGGTGGGTAGATCATA
JMFS023D07+ TTAAGTCCAAAAATGTTAGGCATGCGCCGGGGTGGGTGGGTGGGTAGATCATA
JMFS144A11+ TTAAGTCCAAAAATGTTAGGCATGCGCCGGGGTGGGTGGGTGGGTAGATCATAGATGTAA
                      ____________________________________________________________
consensus TTAAGTCCAAAAATGTTAGGCATGCGCCGGGGTGGGTGGGTGGGTAGATCATAGATGTAA