Previous Contig 004071:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS097G01Sequence627004071 (2)pir|D84889|D848893e-39probable receptor-like protein kinase [imported] - Arabidopsis thaliana>gb:AC002
JMFS143G02Sequence624004071 (2)pir|D84889|D848893e-39probable receptor-like protein kinase [imported] - Arabidopsis thaliana>gb:AC002

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS097G01+ CAAGCTTATTAGGTATGCACCCTTCAAATC
JMFS143G02+ TATTAGGTATGCACCCTTCAAATC
                      ____________________________________________________________
consensus CAAGCTTATTAGGTATGCACCCTTCAAATC
 
. : . : . : . : . : . :
JMFS097G01+ TGTTGTAGCAGAGTTGCAAAACTTGAAGATTTGGCATGTTGCCTATCTCAGAAGGAATGA
JMFS143G02+ TGTTGTAGCAGAGTTGCAAAACTTGAAGATTTGGCATGTTGCCTATCTCAGAAGGAATGA
                      ____________________________________________________________
consensus TGTTGTAGCAGAGTTGCAAAACTTGAAGATTTGGCATGTTGCCTATCTCAGAAGGAATGA
 
. : . : . : . : . : . :
JMFS097G01+ AACCAGAGAGGTCATTCATATTGAGATACAAATCTGAGAGCTGAGTGAGGGAAGCAATCT
JMFS143G02+ AACCAGAGAGGTCATTCATATTGAGATACAAATCTGAGAGCTGAGTGAGGGAAGCAATCT
                      ____________________________________________________________
consensus AACCAGAGAGGTCATTCATATTGAGATACAAATCTGAGAGCTGAGTGAGGGAAGCAATCT
 
. : . : . : . : . : . :
JMFS097G01+ CCTTGGGTATAACCCCATGAAGGTTGTTGAAATGGAGGTACAACCCAGATAAGCCATTGA
JMFS143G02+ CCTTGGGTATAACCCCATGAAGGTTGTTGAAATGGAGGTACAACCCAGATAAGCCATTGA
                      ____________________________________________________________
consensus CCTTGGGTATAACCCCATGAAGGTTGTTGAAATGGAGGTACAACCCAGATAAGCCATTGA
 
. : . : . : . : . : . :
JMFS097G01+ GCTGGCCAATCTCAGGTGGTATTTTCCCATAAAGCCCTTTACCCTGCAAGGAGATATTGA
JMFS143G02+ GCTGGCCAATCTCAGGTGGTATTTTCCCATAAAGCCCTTTACCCTGCAAGGAGATATTGA
                      ____________________________________________________________
consensus GCTGGCCAATCTCAGGTGGTATTTTCCCATAAAGCCCTTTACCCTGCAAGGAGATATTGA
 
. : . : . : . : . : . :
JMFS097G01+ CCACCTGGCCAAGGTCATTGCAAGCAATGCCTTCAAAGGAGGAAACACTGCATGGGTCAG
JMFS143G02+ CCACCTGGCCAAGGTCATTGCAAGCAATGCCTTCAAAGGAGGAAACACTGCATGGGTCAG
                      ____________________________________________________________
consensus CCACCTGGCCAAGGTCATTGCAAGCAATGCCTTCAAAGGAGGAAACACTGCATGGGTCAG
 
. : . : . : . : . : . :
JMFS097G01+ TGACATTGGGTGACCAAGAAGAGAGAACAAGGTTTCCAGGGTCTAAGGAGGCCTTGATAG
JMFS143G02+ TGACATTGGGTGACCAAGAAGAGAGAACAAGGTTTCCAGGGTCTAAGGAGGCCTTGATAG
                      ____________________________________________________________
consensus TGACATTGGGTGACCAAGAAGAGAGAACAAGGTTTCCAGGGTCTAAGGAGGCCTTGATAG
 
. : . : . : . : . : . :
JMFS097G01+ CCATGAGGAGGGAGACAGTACTGGCATTATTACTGGTTTCTGAGAGAGAAAGGTCTGGGC
JMFS143G02+ CCATGAGGAGGGAGACAGTACTGGCATTATTACTGGTTTCTGAGAGAGAAAGGTCTGGGC
                      ____________________________________________________________
consensus CCATGAGGAGGGAGACAGTACTGGCATTATTACTGGTTTCTGAGAGAGAAAGGTCTGGGC
 
. : . : . : . : . : . :
JMFS097G01+ ATAATAGTAGTAGTAGTGTGGAGAAGAACAAGAAGATGAGAGAGATGAAAGCAGCCATTT
JMFS143G02+ ATAATAGTAGTAGTAGTGTGGAGAAGAACAAGAAGATGAGAGAGATGAAAGCAGCCATTT
                      ____________________________________________________________
consensus ATAATAGTAGTAGTAGTGTGGAGAAGAACAAGAAGATGAGAGAGATGAAAGCAGCCATTT
 
. : . : . : . : . : . :
JMFS097G01+ TTGGTTTGGCTTTTCAAGAAAATAGAGCTGGTTTTTCCTGTAAAACGTGGGATTCTTCTG
JMFS143G02+ TTGGTTTGGCTTTTCAAGAAAATAGAGCTGGTTTTTCCTGTAAAACGTGGGATTCTTCTG
                      ____________________________________________________________
consensus TTGGTTTGGCTTTTCAAGAAAATAGAGCTGGTTTTTCCTGTAAAACGTGGGATTCTTCTG
 
. : . : . : . : . : . :
JMFS097G01+ AGGTGTTGATTCAAAATGGCATTAATGGAGTATTTACAAGCTCCTAGGGGGAAGAGA
JMFS143G02+ AGGTGTTGATTCAAAATGGCATTAATGGAGTATTTACAAGCTCCTAGGGGGAAGAGAGAT
                      ____________________________________________________________
consensus AGGTGTTGATTCAAAATGGCATTAATGGAGTATTTACAAGCTCCTAGGGGGAAGAGAGAT