Previous Contig 004069:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS028C05Sequence629004069 (5)pir|T05845|T058452e-06hypothetical protein F17L22.160 - Arabidopsis thaliana>gb:ATCHRIV55_1546007 Arab
JMFS072G03Sequence627004069 (5)pir|T05845|T058456e-07hypothetical protein F17L22.160 - Arabidopsis thaliana>gb:ATCHRIV55_1546007 Arab
JMFS143F07Sequence614004069 (5)pir|T05845|T058450.018hypothetical protein F17L22.160 - Arabidopsis thaliana>gb:ATCHRIV55_1546007 Arab
JMSF016K13Sequence244004069 (5)794011906 (2)pir|T05845|T058452e-53hypothetical protein F17L22.160 - Arabidopsis thaliana>gb:ATCHRIV55_1546007 Arab
JMSF047K24Sequence617004069 (5)pir|T05845|T058455e-05hypothetical protein F17L22.160 - Arabidopsis thaliana>gb:ATCHRIV55_1546007 Arab276011906 (2)pir|T05845|T058452e-10hypothetical protein F17L22.160 - Arabidopsis thaliana>gb:ATCHRIV55_1546007 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS072G03+ GCAGGCTT
JMFS028C05+ GCAGGCTT
                      ____________________________________________________________
consensus GCAGGCTT
 
. : . : . : . : . : . :
JMFS072G03+ CCATGAACANAACCGCTGGAGATGTCGGAGTTCTTCTTTGCAAAAGAGAGCCTGAGAACG
JMFS028C05+ CCATGAACANAACCGCTGGAGATGTCGGAG-TCTTCTTTGCAAAAGAGAGCCTGAGAACG
JMSF047K24+ GCAAAAGAGAGCCTGAGAACG
                      ____________________________________________________________
consensus CCATGAACANAACCGCTGGAGATGTCGGAGTTCTTCTTTGCAAAAGAGAGCCTGAGAACG
 
. : . : . : . : . : . :
JMFS072G03+ GCTTCAACATACTCAGGCTTCCCTTCCTTGGAATACCAGGAAGCTGATCCCACCATGCAA
JMFS028C05+ GCTTCAACATACTCAGGCTTCCCTTCCTTGGAATACCAGGAAGCTGATCCCACCATGCAA
JMSF047K24+ GCTTCAACATACTCAGGCTTCCCTTCCTTGGAATACCAGGAAGCTGATCCCACCATGCAA
                      ____________________________________________________________
consensus GCTTCAACATACTCAGGCTTCCCTTCCTTGGAATACCAGGAAGCTGATCCCACCATGCAA
 
. : . : . : . : . : . :
JMFS072G03+ AGCTTCCCAGAACTCTCCGAGAAATAGCCGCTCAAGAGGAACGACAATTCCCGTGGCCCA
JMFS028C05+ AGCTTCCCAGAACTCTCCGAGAAATAGCCGCTCAAGAGGAACGACAATTCCCGTGGCCCA
JMSF047K24+ AGCTTCCCAGAACTCTCCGAGAAATAGCCGCTCAAGAGGAACGACAATTCCCGTGGCCCA
JMFS143F07+ ATTCCCGTGGCCCA
                      ____________________________________________________________
consensus AGCTTCCCAGAACTCTCCGAGAAATAGCCGCTCAAGAGGAACGACAATTCCCGTGGCCCA
 
. : . : . : . : . : . :
JMFS072G03+ CTGTAATTCCCAGCAGCATAATACGACCACCCATAGGATCCATATCTGGAATATTTATAA
JMFS028C05+ CTGTAATTCCCAGCAGCATAATACGACCACCCATAGGATCCATATCTGGAATATTTATAA
JMSF047K24+ CTGTAATTCCCAGCAGCATAATACGACCACCCATAGGATCCATATCTGGAATATTTATAA
JMFS143F07+ CTGTAATTCCCAGCAGCATAATACGTCCACCCATAGGATCCATATCTGGAATATTTATAA
                      ____________________________________________________________
consensus CTGTAATTCCCAGCAGCATAATACGACCACCCATAGGATCCATATCTGGAATATTTATAA
 
. : . : . : . : . : . :
JMFS072G03+ GAATCATCCTCCACATAAGAGGGTCTGAGCGTCAAGGACGCTTTAAGTTTAAAAATTTCA
JMFS028C05+ GAATCATCCTCCACATAAGAGGGTCTGAGCGTCAAGGACGCTTTAAGTTTAAAAATTTCA
JMSF047K24+ GAATCATCCTCCACATAAGAGGGTCTGAGCGTCAAGGACGCTTTAAGTTTAAAAATTTCA
JMFS143F07+ GAATCATCCTCCACATAAGAGGGTCTGAGCGTCAAGGACGCTTTAAGTTTAAAAATTTCA
                      ____________________________________________________________
consensus GAATCATCCTCCACATAAGAGGGTCTGAGCGTCAAGGACGCTTTAAGTTTAAAAATTTCA
 
. : . : . : . : . : . :
JMFS072G03+ GGATCCTCTGTCGTGTAAGCGGATTTCTGGGTGGGCTGGAAGGTAAGAGAATTGATGGAG
JMFS028C05+ GGATCCTCTGTCGTGTAAGCGGATTTCTGGGTGGGCTGGAAGGTAAGAGAATTGATGGAG
JMSF047K24+ GGATCCTCTGTCGTGTAAGCGGATTTCTGGGTGGGCTGGAAGGTAAGAGAATTGATGGAG
JMFS143F07+ GGATCCTCTGTCGTGTAAGCGGATTTCTGGGTGGGCTGGAAGGTAAGAGAATTGATGGAG
                      ____________________________________________________________
consensus GGATCCTCTGTCGTGTAAGCGGATTTCTGGGTGGGCTGGAAGGTAAGAGAATTGATGGAG
 
. : . : . : . : . : . :
JMFS072G03+ GTATTAGACAACTGACCAAGTGATTTACTGGTCCATAAACTCTCACCGCCATGGTAGTAG
JMFS028C05+ GTATTAGACAACTGACCAAGTGATTTACTGGTCCATAAACTCTCACCGCCATGGTAGTAG
JMSF047K24+ GTATTAGACAACTGACCAAGTGATTTACTGGTCCATAAACTCTCNCCGCCATGGTAGTAG
JMSF016K13+ ATGGTAGTAG
JMFS143F07+ GTATTAGACACCTGACCAAGTGATTTACTGGTCCATAAACTCTCACCGCCATGGTAGTAG
                      ____________________________________________________________
consensus GTATTAGACAACTGACCAAGTGATTTACTGGTCCATAAACTCTCACCGCCATGGTAGTAG
 
. : . : . : . : . : . :
JMFS072G03+ CTACTCGCAGTGGAGAGGTAAGGTAAAATGTCAGAATGATGAACACGTTGAGTCGGGGTA
JMFS028C05+ CTACTCGCAGTGGAGAGGTAAGGTAAAATGTCAGAATGATGAACACGTTGAGTCGGGGTA
JMSF047K24+ CTACTCGCAGTGGAGAGGTAAGGTAAAATGTCAGAAAGATGAACACGTTGAGTCGGGGTA
JMSF016K13+ CTACTCGCAGTGGAGAGNTAAGGTAAAATGTCAGAATGATGAACACGTTGAGTCGGGGTA
JMFS143F07+ CTACTCGCAGTGGAGAGGTAAGGTAAAATGTCAGAATGATGAACACGTTGAGTCGGGGTA
                      ____________________________________________________________
consensus CTACTCGCAGTGGAGAGGTAAGGTAAAATGTCAGAATGATGAACACGTTGAGTCGGGGTA
 
. : . : . : . : . : . :
JMFS072G03+ GACTCAGATACATATGAAGAGCAGTGATAAGAGTATGGAATTTCAGGAATATTGGAAGAA
JMFS028C05+ GACTCAGATACATATGAAGAGCAGTGATAAGAGTATGGAATTTCAGGAATATTGGAAGAA
JMSF047K24+ GACTCAGATACATATGAAGAGCAGTGATAAGAGTATGGAATTTCAGGAATATTGGAAGAA
JMSF016K13+ GACTCAGATACATATGAAGAGCAGTGATAAGAGTATGGAATTTCAGGAATATTGGAAGAA
JMFS143F07+ GACTCAGATACATATGAAGAGCAGTGATAAGAGTATGGAATTTCAGGAATATTGGAAGAA
                      ____________________________________________________________
consensus GACTCAGATACATATGAAGAGCAGTGATAAGAGTATGGAATTTCAGGAATATTGGAAGAA
 
. : . : . : . : . : . :
JMFS072G03+ GAAGAAACTGAGGATAAGCAAAATATAGAGAGAAGTAAGAAAACAGGTAAAGGAAAGATG
JMFS028C05+ GAAGAAACTGAGGATAAGCAAAATATAGAGAGAAGTAAGAAAACAGGTAAAGGAAAGATG
JMSF047K24+ GAAGAAACTGAGGATAAGCAAAATATAGAGAGAAGTAAGAAAACAGGTAAAGGAAAGATG
JMSF016K13+ GAAGAAACTGAGGATAAGCAAAATATAGAGAGAAGTAAGAAAACAGGTAAAGGAAAGATG
JMFS143F07+ GAAGAAACTGAGGATAAGCAAAATATAGAGAGAAGTAAGAAAACAGGTAAAGGAAAGATG
                      ____________________________________________________________
consensus GAAGAAACTGAGGATAAGCAAAATATAGAGAGAAGTAAGAAAACAGGTAAAGGAAAGATG
 
. : . : . : . : . : . :
JMFS072G03+ ACAGAAGAAGAAGAAGAAA
JMFS028C05+ ACAGAAGAAGAAGAAGAAAGGT
JMSF047K24+ ACAGAAGAAGAAGAAGAAAGGTGTATAGCCATAATCATGCAATGGAGAAAGA
JMSF016K13+ ACAGAAGAAGAAGAAGAAAGGTGTATAGCCATAATCATGCAATGGAGAAAGA
JMFS143F07+ ACAGAAGAAGAAGAAGAAAGGTGTATAGCCATAATCATGCAATGGAGAAAGATGAAGATT
                      ____________________________________________________________
consensus ACAGAAGAAGAAGAAGAAAGGTGTATAGCCATAATCATGCAATGGAGAAAGATGAAGATT
 
. : . : . : . : . : . :
JMFS143F07+ CCTGCAATGGGAATCTTTACTTTATAGTGCTAGTTCTACGTATCCAGCAAGACTTGGCAG
                      ____________________________________________________________
consensus CCTGCAATGGGAATCTTTACTTTATAGTGCTAGTTCTACGTATCCAGCAAGACTTGGCAG
 
. : . : . : . : . : . :
JMFS143F07+ ACCCCAAGTCAACGCCCACAGTTTCCTTCCACTTTCTTCCACTTTTAATTTTGCATCGAA
                      ____________________________________________________________
consensus ACCCCAAGTCAACGCCCACAGTTTCCTTCCACTTTCTTCCACTTTTAATTTTGCATCGAA