Previous Contig 004064:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN003H17Sequence518004064 (5)gb:AY093171_15751256e-29Arabidopsis thaliana unknown protein (At3g28920) mRNA, complete cds.>gb:AY128820
JMFN015G19Sequence673004064 (5)gb:AY093171_15751251e-28Arabidopsis thaliana unknown protein (At3g28920) mRNA, complete cds.>gb:AY128820
JMFN018C16Sequence588004064 (5)gb:AY093171_15751258e-29Arabidopsis thaliana unknown protein (At3g28920) mRNA, complete cds.>gb:AY128820
JMFS031D06Sequence332004064 (5)gb:AC146506_17445912e-15Solanum demissum chromosome 5 BAC PGEC989P08 genomic sequence, complete sequence
JMFS143B10Sequence595004064 (5)gb:FBI18580_16788688e-21Flaveria bidentis mRNA for ZF-HD homeobox protein (hb3 gene), clone FbHB3.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN015G19+ AACATTTGTCTTCTGATCTGGGTGAATTTGTTCGGAACCGCTTCCTGGCGT
                      ____________________________________________________________
consensus AACATTTGTCTTCTGATCTGGGTGAATTTGTTCGGAACCGCTTCCTGGCGT
 
. : . : . : . : . : . :
JMFN015G19+ TAGGATTTGACGGAGGAGTGACGGCGGTGACGGAGATGGGGGCGGTGTTGTCCGTTTGTA
                      ____________________________________________________________
consensus TAGGATTTGACGGAGGAGTGACGGCGGTGACGGAGATGGGGGCGGTGTTGTCCGTTTGTA
 
. : . : . : . : . : . :
JMFN015G19+ GCGCGGACAGTCCCGTGCCGAGTGCGAGAAGCACGTGAGACGCGGAGGGGTAATACGCCG
                      ____________________________________________________________
consensus GCGCGGACAGTCCCGTGCCGAGTGCGAGAAGCACGTGAGACGCGGAGGGGTAATACGCCG
 
. : . : . : . : . : . :
JMFN015G19+ AGGAGATCGGCGGCGGGGACGAGGAATTCGGGCTGCTATGGCACCCGCTGCCGCCGCCGC
JMFN003H17+ ACGAGGAATTCGGGCTGGTATGGCACCCGCTGCCGCCGCCGC
JMFN018C16+ ACGAGGAATCGGGGCTGCTATGGCACCCGCTGCCGCCGCCGC
                      ____________________________________________________________
consensus AGGAGATCGGCGGCGGGGACGAGGAATTCGGGCTGCTATGGCACCCGCTGCCGCCGCCGC
 
. : . : . : . : . : . :
JMFN015G19+ CGCGGTGACCCTGCGGCGGCGGCGGAGGAGGGTGGTGGCGGTGGTGCGGCTGGTACTCAA
JMFN003H17+ CGCGGTGACCNTACGNCGNCGGCGGAGGAGGGTGGTGNCGGTGGTGCGGCTGGTACTCAA
JMFN018C16+ CGCGGTGACCCTGCGGCGGCGGCGGAGAAGGGTGGTGNCGGTGGTNCGGCTGGTACTCAA
                      ____________________________________________________________
consensus CGCGGTGACCCTGCGGCGGCGGCGGAGGAGGGTGGTGGCGGTGGTGCGGCTGGTACTCAA
 
. : . : . : . : . : . :
JMFN015G19+ GCGCCGCCACCGCGTCGTGCGGGGAAAGCACCTCCTCCGGCGGCTCACGGCGGTGGAAAT
JMFS031D06+ GTCGTGCGGGGAAAGCACCTCCTCCGGCGGCTCACGGCGGTGGAAAT
JMFN003H17+ GCGCCGCCACCGCGTCGTGCGGGGAAAGCACCTCCTCCGGCGGCTCACGGCGGTGGAAAT
JMFN018C16+ GCGCCGCCACCGCGTCGTGCGGGGAAAGCACCTCCTCCGGCGGCTCACGGCGGTGGAAAT
                      ____________________________________________________________
consensus GCGCCGCCACCGCGTCGTGCGGGGAAAGCACCTCCTCCGGCGGCTCACGGCGGTGGAAAT
 
. : . : . : . : . : . :
JMFN015G19+ TACGGTGACACCCACACGCCGCGCATTTCAGGGAGGTCGGGTCGGCCGGGTTAGCCGTCG
JMFS031D06+ TACGGTGACACCCACACGCCGCGCATTTCAGGGAGGTCGGGTCGGCCGGGTTAGCCGTCG
JMFN003H17+ TACGGTGACACCCACACGCCGCGCATTTCAGGGAGGTCGGGTCGGCCGGGTTAGCCGTCG
JMFN018C16+ TACGGTGACACCCACACGCCGCGCATTTCAGGGAGGTCGGGTCGGCCGGGTTAGCCGTCG
JMFS143B10+ TGACACCCACACGCCGCGCATTTCAGGGAGGTCGGGTCGGCCGGGTTAGCCGTCG
                      ____________________________________________________________
consensus TACGGTGACACCCACACGCCGCGCATTTCAGGGAGGTCGGGTCGGCCGGGTTAGCCGTCG
 
. : . : . : . : . : . :
JMFN015G19+ GCGAAGCCATAAACTCCCCACACCCATCCACCGCATGCCCCCCCAGCGCCGCCGCGTGAT
JMFS031D06+ GCGAAGCCATAAACTCCCCACACCCATCCACCGCATGCC
JMFN003H17+ GCGAAGCCATAAACTCCCCACACCCATCCACCGCATGCCCCCCCAGCGCCGCCGCGTGAT
JMFN018C16+ GCGAAGCCATAAACTCCCCACACCCATCCACCGCATGCCCCCCCAGCGCCGCCGCGTGAT
JMFS143B10+ GCGAAGCCATAAACTCCCCACACCCATCCACCGCATGCCCCCCCAGCGCCGCCGCGTGAT
                      ____________________________________________________________
consensus GCGAAGCCATAAACTCCCCACACCCATCCACCGCATGCCCCCCCAGCGCCGCCGCGTGAT
 
. : . : . : . : . : . :
JMFN015G19+ TCTTCAAACATTCCCTGTAGTGCACCACCACGGGGTGGTGGTGCCCGTTGCTCCCAAACC
JMFN003H17+ TCTTCAAACATTCCCTGTAGTGCACCACCACGGGGTGGTGGTGCCCGTTGCTCCCAAACC
JMFN018C16+ TCTTCAAACATTCCCTGTAGTGCACCACCACGGGGTGGTGGTGCCCGTTGCTCCCAAACC
JMFS143B10+ TCTTCAAACATTCCCTGTAGTGCACCACCACGGGGTGGTGGTGCCCGTTGCTCCCAAACC
                      ____________________________________________________________
consensus TCTTCAAACATTCCCTGTAGTGCACCACCACGGGGTGGTGGTGCCCGTTGCTCCCAAACC
 
. : . : . : . : . : . :
JMFN015G19+ CACCCCCGTGACGGGGGTGGTTCAGCCGTTTCAGCACCCCGTTGCTGCTGTACGACAACG
JMFN003H17+ CACCCCCGTGACGGGGGTGGTTCAGCCGTTTCAGCACCCCGTTGCTGCTGTACGACAACG
JMFN018C16+ CACCCCCGTGACGGGGGTGGTTCAGCCGTTTCAGCACCCCGTTGCTGCTGTACGACAACG
JMFS143B10+ CACCCCCGTGACGGGGGTGGTTCAGCCGTTTCAGCACCCCGTTGCTGCTGTACGACAACG
                      ____________________________________________________________
consensus CACCCCCGTGACGGGGGTGGTTCAGCCGTTTCAGCACCCCGTTGCTGCTGTACGACAACG
 
. : . : . : . : . : . :
JMFN015G19+ GCTTCGCCGGGTAGATCCGCGCCGCCGCCGTCGGCGTCTCCGTGTCCGCCTCCGGCGTCT
JMFN003H17+ GCTTCGCCGGGTAGATCCGCGCCGCCGCCGTCGGCGTCTCCGTGTCCGCCTCCGGCGTCT
JMFN018C16+ GCTTCGCCGGGTAGATCCGCGCCGCCGCCGTCGGCGTCTCCGTGTCCGCCTCCGGCGTCT
JMFS143B10+ GCTTCGCCGGGTAGATCCGCGCCGCCGCCGTCGGCGTCTCCGTGTCCGCCTCCGGCGTCT
                      ____________________________________________________________
consensus GCTTCGCCGGGTAGATCCGCGCCGCCGCCGTCGGCGTCTCCGTGTCCGCCTCCGGCGTCT
 
. : . : . : . : . : . :
JMFN015G19+ TCACAGTCGCCGCC
JMFN003H17+ TCACAGTCGCCGCCGCCGCCGCCCCGCAGCTGCTACTTATCTCCATCCCTT
JMFN018C16+ TCACAGTCGCCGCCGCCGCCGCCCCGCAGCTGCTACTTATCTCCATCCCTTAAAAAACCC
JMFS143B10+ TCACAGTCGCCGCCGCCGCCGCCCCGCAGCTGCTACTTATCTCCATCCCTTAAAAAACCC
                      ____________________________________________________________
consensus TCACAGTCGCCGCCGCCGCCGCCCCGCAGCTGCTACTTATCTCCATCCCTTAAAAAACCC
 
. : . : . : . : . : . :
JMFN018C16+ TCCCACCAGTGGGGCTTCCACTCTTTAAACCTTAAAAACCACTTTTCCCAGTTTCCCCCT
JMFS143B10+ TCCCACCAGTGGGGCTTCCACTCTTTAAACCTTAAAAACCACTTTTCCCAGTTTCCCCCT
                      ____________________________________________________________
consensus TCCCACCAGTGGGGCTTCCACTCTTTAAACCTTAAAAACCACTTTTCCCAGTTTCCCCCT
 
. : . : . : . : . : . :
JMFN018C16+ ATTCTC
JMFS143B10+ ATTCTCTTACGAGGTTAATCCGACGAACATAGGGCCAAGATTTCACACAAACATCTTATC
                      ____________________________________________________________
consensus ATTCTCTTACGAGGTTAATCCGACGAACATAGGGCCAAGATTTCACACAAACATCTTATC
 
. : . : . : . : . : . :
JMFS143B10+ CAAACCCGTGAGGGGCCGATTGAGAGGATGAAGTTTCAGTGATGGGTTTGTTTTGGAATT
                      ____________________________________________________________
consensus CAAACCCGTGAGGGGCCGATTGAGAGGATGAAGTTTCAGTGATGGGTTTGTTTTGGAATT
 
. : . : . : . : . : . :
JMFS143B10+ ACGTTTGATGAAAGATAAAACGGTGTTGAGGGATATATGGTTTCTAGTATGCCGGATTAA
                      ____________________________________________________________
consensus ACGTTTGATGAAAGATAAAACGGTGTTGAGGGATATATGGTTTCTAGTATGCCGGATTAA