Previous Contig 004063:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS143A04Sequence614004063 (2)
JMSF018D07Sequence510004063 (2)756012488 (4)gb:AY085069_15701514e-56Arabidopsis thaliana clone 126195 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS143A04+ AAGAAGCATTAGGA
                      ____________________________________________________________
consensus AAGAAGCATTAGGA
 
. : . : . : . : . : . :
JMFS143A04+ GGAAAAGTAGAGGTTCCCCCATCACGATTGTCAGCTGACTTTGAGGGCTTCCGTGGGAGT
                      ____________________________________________________________
consensus GGAAAAGTAGAGGTTCCCCCATCACGATTGTCAGCTGACTTTGAGGGCTTCCGTGGGAGT
 
. : . : . : . : . : . :
JMSF018D07+ TCATCACTGGGAACTACAGGATTAAGTTCACTTCAAGTAAT
JMFS143A04+ CTGTTGAGTATCTGTTTGATCATCACTGGGAACTACAGGATTAAGTTCACTTCAAGTAAT
                      ____________________________________________________________
consensus CTGTTGAGTATCTGTTTGATCATCACTGGGAACTACAGGATTAAGTTCACTTCAAGTAAT
 
. : . : . : . : . : . :
JMSF018D07+ CCTAACAGGTATGTTGATTGAATAGCTTACAACAGAGTGCAAACCACAAATGATAATAAC
JMFS143A04+ CCTAACAGGTATGTTGATTGAATAGCTTACAACAGAGTGCAAACCACAAATGATAATAAC
                      ____________________________________________________________
consensus CCTAACAGGTATGTTGATTGAATAGCTTACAACAGAGTGCAAACCACAAATGATAATAAC
 
. : . : . : . : . : . :
JMSF018D07+ ATTTGCAGCAACAATCAGGAAATCAACCCAATCAAACCTGCTAACAGCAACCCAGTGAGG
JMFS143A04+ ATTTGCAGCAACAATCAGGAAATCAACCCAATCAAACCTGCTAACAGCAACCCAGTGAGG
                      ____________________________________________________________
consensus ATTTGCAGCAACAATCAGGAAATCAACCCAATCAAACCTGCTAACAGCAACCCAGTGAGG
 
. : . : . : . : . : . :
JMSF018D07+ ATCTAATCACCTCATAGGCTCTCTGTGTTCCTGACCAACAGAATCCAACATCCACAGTCT
JMFS143A04+ ATCTAATCACCTCATAGGCTCTCTGTGTTCCTGACCAACAGAATCCAACATCCACAGTCT
                      ____________________________________________________________
consensus ATCTAATCACCTCATAGGCTCTCTGTGTTCCTGACCAACAGAATCCAACATCCACAGTCT
 
. : . : . : . : . : . :
JMSF018D07+ ATGAATTCAAGTTCTTGTTCTTCTACTCTAAGTGAAAAAATCCCTTCCTTATCT
JMFS143A04+ ATGAATTCAAGTTCTTGTTCTTCTACTCTAAGTGAAAAAATCCCTTCCTTATCTGGCCAG
                      ____________________________________________________________
consensus ATGAATTCAAGTTCTTGTTCTTCTACTCTAAGTGAAAAAATCCCTTCCTTATCTGGCCAG
 
. : . : . : . : . : . :
JMFS143A04+ TTAAAACAGTTAACATAAGAAAACCAAAATGAAGAACATCAAGGTTAACCGATTGTATAA
                      ____________________________________________________________
consensus TTAAAACAGTTAACATAAGAAAACCAAAATGAAGAACATCAAGGTTAACCGATTGTATAA
 
. : . : . : . : . : . :
JMFS143A04+ AAGTCAAATCTCGCTACTAATCCAGCATCCAAAAGTCAAATTCCCCATTTTTTATGAAAA
                      ____________________________________________________________
consensus AAGTCAAATCTCGCTACTAATCCAGCATCCAAAAGTCAAATTCCCCATTTTTTATGAAAA
 
. : . : . : . : . : . :
JMFS143A04+ TTTTTGTACCAAGTTGGTGAAAGTTTTCTTTTTTTCCCCAACTGTGCAGTGCAAGTATAG
                      ____________________________________________________________
consensus TTTTTGTACCAAGTTGGTGAAAGTTTTCTTTTTTTCCCCAACTGTGCAGTGCAAGTATAG
 
. : . : . : . : . : . :
JMFS143A04+ GTTTAAGCCCCAAACACCCACTATAACAATCAAATCTGCTGACCCATTAAGCTCTCCTCA
                      ____________________________________________________________
consensus GTTTAAGCCCCAAACACCCACTATAACAATCAAATCTGCTGACCCATTAAGCTCTCCTCA