Previous Contig 004062:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS142H12Sequence620004062 (2)gb:AE016959_10234321e-22Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06
JMFS155E01Sequence627004062 (2)gb:AC007730_15361592e-23Arabidopsis thaliana chromosome 2 BAC T5M2 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS155E01+ GTCACGATTGATCACATCTTCCGTGTA
                      ____________________________________________________________
consensus GTCACGATTGATCACATCTTCCGTGTA
 
. : . : . : . : . : . :
JMFS155E01+ CAGCTNTGAGAAGAATTCTGTAATATAAACTAGGATGGCCTCCTCCGTTTCTAGTCATTC
                      ____________________________________________________________
consensus CAGCTNTGAGAAGAATTCTGTAATATAAACTAGGATGGCCTCCTCCGTTTCTAGTCATTC
 
. : . : . : . : . : . :
JMFS155E01+ ACCTTGGCTGTCCATTAGCTTAGAAATTTTAGAATGTGGTTTTTTTGGCAGCTGTCGAGG
                      ____________________________________________________________
consensus ACCTTGGCTGTCCATTAGCTTAGAAATTTTAGAATGTGGTTTTTTTGGCAGCTGTCGAGG
 
. : . : . : . : . : . :
JMFS155E01+ CATGATAGAACCTCGTGTTCCTGTCCCCCGTTGCTATCCACTCCTCTCGTGAGCTCTGGA
                      ____________________________________________________________
consensus CATGATAGAACCTCGTGTTCCTGTCCCCCGTTGCTATCCACTCCTCTCGTGAGCTCTGGA
 
. : . : . : . : . : . :
JMFS155E01+ ACCAGTAGAGCTCTTCTTGGCTCAAAATTTTTTCTAACTCTTTTTGCAGCTTCTTGCTCA
                      ____________________________________________________________
consensus ACCAGTAGAGCTCTTCTTGGCTCAAAATTTTTTCTAACTCTTTTTGCAGCTTCTTGCTCA
 
. : . : . : . : . : . :
JMFS155E01+ ATTTTATTAGGTCCGACCTTGGACGAATTTCGATTGCCCTTTGGACCCCTTTAATCCTGG
                      ____________________________________________________________
consensus ATTTTATTAGGTCCGACCTTGGACGAATTTCGATTGCCCTTTGGACCCCTTTAATCCTGG
 
. : . : . : . : . : . :
JMFS155E01+ CTAGTACCCTTCGTTTCCTTTGGAAAATGTTCTCGAAAGAGCTATGATTCCAATCTTGCA
JMFS142H12+ GCTATGATTCCAATCTTGCA
                      ____________________________________________________________
consensus CTAGTACCCTTCGTTTCCTTTGGAAAATGTTCTCGAAAGAGCTATGATTCCAATCTTGCA
 
. : . : . : . : . : . :
JMFS155E01+ GTTTCCTTGCTAGTTCCTCCTTAGCATGATCCAGATCATAATCAGCATTCCAATTTTCTT
JMFS142H12+ GTTTCCTTGCTAGTTCCTCCTTAGCATGATCCAGATCATAATCAGCATTCCAATTTTCTT
                      ____________________________________________________________
consensus GTTTCCTTGCTAGTTCCTCCTTAGCATGATCCAGATCATAATCAGCATTCCAATTTTCTT
 
. : . : . : . : . : . :
JMFS155E01+ TAATGAATTTCGAGAAATCGGGGTGAGTGGACCAAGCTACATTATACTTGAAGTTTCTCA
JMFS142H12+ TAATGAATTTCGAGAAATCGGGGTGAGTGGACCAAGCTACATTATACTTGAAGTTTCTCA
                      ____________________________________________________________
consensus TAATGAATTTCGAGAAATCGGGGTGAGTGGACCAAGCTACATTATACTTGAAGTTTCTCA
 
. : . : . : . : . : . :
JMFS155E01+ GCCCAGCACACTTCTGACTTTCCTTTGTTCTTATAAGGAGAGGTGCATGGTCCGATCCGA
JMFS142H12+ GCCCAGCACACTTCTGACTTTCCTTTGTTCTTATAAGGAGAGGTGCATGGTCCGATCCGA
                      ____________________________________________________________
consensus GCCCAGCACACTTCTGACTTTCCTTTGTTCTTATAAGGAGAGGTGCATGGTCCGATCCGA
 
. : . : . : . : . : . :
JMFS155E01+ CCATGGGCAAATGTAGTACACTTGCATCCAGGAAGCGCATTCTCCACTCCGAATTGCACA
JMFS142H12+ CCATGGGCAAATGTAGTACACTTGCATCCAGGAAGCGCATTCTCCACTCCGAATTGCACA
                      ____________________________________________________________
consensus CCATGGGCAAATGTAGTACACTTGCATCCAGGAAGCGCATTCTCCACTCCGAATTGCACA
 
. : . : . : . : . : . :
JMFS142H12+ GAGCACGATCTAGCCTAGCTGCTTTAAAAGATGTTAAGCTTAGTCCTCTACACCATGTGA
                      ____________________________________________________________
consensus GAGCACGATCTAGCCTAGCTGCTTTAAAAGATGTTAAGCTTAGTCCTCTACACCATGTGA
 
. : . : . : . : . : . :
JMFS142H12+ ACTGAGGGCCCTCAAATCCGACATTTATTAGTCCTTCCTCAAAGATCCAATTCCTAAAAC
                      ____________________________________________________________
consensus ACTGAGGGCCCTCAAATCCGACATTTATTAGTCCTTCCTCAAAGATCCAATTCCTAAAAC
 
. : . : . : . : . : . :
JMFS142H12+ CTGCACATCTGGAAGACGAAAAATTAGTACTGCCGGACACTTCATCTACTGAGAGAACTG
                      ____________________________________________________________
consensus CTGCACATCTGGAAGACGAAAAATTAGTACTGCCGGACACTTCATCTACTGAGAGAACTG
 
. : . : . : . : . : . :
JMFS142H12+ AATTATAGTCCCCTGCTATTAACCAAGGACCATGGAAATTAAGGCCCTCCTGAGACAAGT
                      ____________________________________________________________
consensus AATTATAGTCCCCTGCTATTAACCAAGGACCATGGAAATTAAGGCCCTCCTGAGACAAGT
 
. : . : . : . : . : . :
JMFS142H12+ CCTCAAAGAGGTGTCTTCTGAGGGCATGGTCAGGACTACCATATACGAAGGAAAGATTCC
                      ____________________________________________________________
consensus CCTCAAAGAGGTGTCTTCTGAGGGCATGGTCAGGACTACCATATACGAAGGAAAGATTCC
 
. : . : . : . : . : . :
JMFS142H12+ ACGGTGTTGTGTTATCTTCCATAATTTCTAGTAGGACGAATTGGGGATGGGTTCTAGAGA
                      ____________________________________________________________
consensus ACGGTGTTGTGTTATCTTCCATAATTTCTAGTAGGACGAATTGGGGATGGGTTCTAGAGA