Previous Contig 004059:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS016E03Sequence573004059 (7)gb:PSY250467_17026005e-31Pinus sylvestris mRNA for receptor protein kinase (upk gene).
JMFS022B04Sequence627004059 (7)gb:AB017061_15133137e-24Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19E20.
JMFS093C06Sequence615004059 (7)gb:AB017061_15133134e-19Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19E20.
JMFS094C06Sequence625004059 (7)gb:AB017061_15133133e-14Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19E20.
JMFS112C01Sequence616004059 (7)gb:AB017061_15133133e-25Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19E20.
JMFS142H02Sequence623004059 (7)gb:AB017061_15133133e-04Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19E20.
JMFS166B06Sequence613004059 (7)gb:AB017061_15133139e-15Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19E20.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS016E03+ GATTTCTCCAACAATTCCCAAATTCCCTCCAGCCCGGAATATT
                      ____________________________________________________________
consensus GATTTCTCCAACAATTCCCAAATTCCCTCCAGCCCGGAATATT
 
. : . : . : . : . : . :
JMFS016E03+ CTNAGATTAGGGGACTGCCCAATCTCAGCAGGAATCATCCCAGAAAGCAAGTTATCAAAG
JMFS112C01+ TCAGCAGGAATCATCCCAGAAAGCAAGTTATCAAAG
JMFS022B04+ AGAAAGCAAGTTATCAAAG
                      ____________________________________________________________
consensus CTNAGATTAGGGGACTGCCCAATCTCAGCAGGAATCATCCCAGAAAGCAAGTTATCAAAG
 
. : . : . : . : . : . :
JMFS016E03+ AGCTCAAGCTGCTGCAACTTTGAGCAGTTCCCAATTTCCTTTGGAATTTCACCATGAATG
JMFS112C01+ AGCTCAAGCTGCTGCAACTTTGAGCAGTTCCCAATTTCCTTTGGAATTTCACCATGAATG
JMFS022B04+ AGCTCAAGCTGCTGCAACTTTGAGCAGTTCNCAATTTCCTTTGGAATTTCACCATGAATG
                      ____________________________________________________________
consensus AGCTCAAGCTGCTGCAACTTTGAGCAGTTCCCAATTTCCTTTGGAATTTCACCATGAATG
 
. : . : . : . : . : . :
JMFS016E03+ AGGTTGGAGCTGAGTGACAGCTGCTGCAGTTGTGATAATCTCCCAATCTTTGGCGGAATA
JMFS112C01+ AGGTTGGAGCTGAGTGACAGCTGCTGCAGTTGTGATAATCTCCCAATCTTTGGCGGAATA
JMFS022B04+ AGGTTGGAGCTGAGTGACAGCTGCTGCAGTTGTGATAATCTCCCAATCTTTGGCGGAATA
JMFS093C06+ CTGAGTGACAGCTGCTGCAGTTGTGATAATCTCCCAATCTTTGGCGGAATA
JMFS166B06+ GAATA
JMFS094C06+ A
                      ____________________________________________________________
consensus AGGTTGGAGCTGAGTGACAGCTGCTGCAGTTGTGATAATCTCCCAATCTTTGGCGGAATA
 
. : . : . : . : . : . :
JMFS016E03+ CTTCCCGTTAGAGCATTGAAACTAAGGTCTAGTGTGATCAGGGATGACAAGTTTCCGATG
JMFS112C01+ CTTCCCGTTAGAGCATTGAAACTAAGGTCTAGTGTGATCAGGGATGACAAGTTTCCGATG
JMFS022B04+ CTTCCCGTTAGAGCATTGAAACTAAGGTCTAGTGTGATCAGGGATGACAAGTTTCCGATG
JMFS093C06+ CTTCCCGTTAGAGCATTGAAACTAAGGTCTAGTGTGATCAGGGATGACAAGTTTCCGATG
JMFS166B06+ CTTCCCGTTAGAGCATTGAAACTAAGGTCTAGTGTGATCAGGGATGACAAGTTTCCGATG
JMFS094C06+ CTTCCCGTTAGAGCATTGAAACTAAGGTCTAGTGTGATCAGGGATGACAAGTTTCCGATG
                      ____________________________________________________________
consensus CTTCCCGTTAGAGCATTGAAACTAAGGTCTAGTGTGATCAGGGATGACAAGTTTCCGATG
 
. : . : . : . : . : . :
JMFS016E03+ GAAGGTGGAATTTCTCCGGTGAGGTTATCATTTGAGAGGACTAGCACTTTGAGGAACCCG
JMFS112C01+ GAAGGTGGAATTTCTCCGGTGAGGTTATCATTTGAGAGGACTAGCACTTTGAGGAACCCG
JMFS022B04+ GAAGGTGGAATTTCTCCGGTGAGGTTATCATTTGAGAGGACTAGCACTTTGAGGAACCCG
JMFS093C06+ GAAGGTGGAATTTCTCCGGTGAGGTTATCATTTGAGAGGACTAGCACTTTGAGGAACCCG
JMFS166B06+ GAAGGTGGAATTTCTCCGGTGAGGTTATCATTTGAGAGGACTAGCACTTTGAGGAACCCG
JMFS094C06+ GAAGGTGGAATTTCTCCGGTGAGGTTATCATTTGAGAGGACTAGCACTTTGAGGAACCCG
JMFS142H02+ AGGACTAGCACTTTGAGGAACCCG
                      ____________________________________________________________
consensus GAAGGTGGAATTTCTCCGGTGAGGTTATCATTTGAGAGGACTAGCACTTTGAGGAACCCG
 
. : . : . : . : . : . :
JMFS016E03+ AAGGAGAGGATTTGAGTAGGAAACTTTGTAGGGAGATTGATAGAAGCTATCTTGATTTCT
JMFS112C01+ AAGGAGAGGATTTGAGTAGGAAACTTTGTAGGGAGATTGATAGAAGCTATCTTGATTTCT
JMFS022B04+ AAGGAGAGGATTTGAGTAGGAAACTTTGTAGGGAGATTGATAGAAGCTATCTTGATTTCT
JMFS093C06+ AAGGAGAGGATTTGAGTAGGAAACTTTGTAGGGAGATTGATAGAAGCTATCTTGATTTCT
JMFS166B06+ AAGGAGAGGATTTGAGTAGGAAACTTTGTAGGGAGATTGATAGAAGCTATCTTGATTTCT
JMFS094C06+ AAGGAGAGGATTTGAGTAGGAAACTTTGTAGGGAGATTGATAGAAGCTATCTTGATTTCT
JMFS142H02+ AAGGAGAGGATTTGAGTAGGAAACTTTGTAGGGAGATTGATAGAAGCTATCTTGATTTCT
                      ____________________________________________________________
consensus AAGGAGAGGATTTGAGTAGGAAACTTTGTAGGGAGATTGATAGAAGCTATCTTGATTTCT
 
. : . : . : . : . : . :
JMFS016E03+ GAAACGAAACCAGTGGTGGTGCATGTGATGAACTCCCACTTGCAAGGATCCGAATGAGCC
JMFS112C01+ GAAACGAAACCAGTGGTGGTGCATGTGATGAACTCCCACTTGCAAGGATCCGAATGAGCC
JMFS022B04+ GAAACGAAACCAGTGGTGGTGCATGTGATGAACTCCCACTTGCAAGGATCCGAATGAGCC
JMFS093C06+ GAAACGAAACCAGTGGTGGTGCATGTGATGAACTCCCACTTGCAAGGATCCGAATGAGCC
JMFS166B06+ GAAACGAAACCAGTGGTGGTGCATGTGATGAACTCCCACTTGCAAGGATCCGAATGAGCC
JMFS094C06+ GAAACGAAACCAGTGGTGGTGCATGTGATGAACTCCCACTTGCAAGGATCCGAATGAGCC
JMFS142H02+ GAAACGAAACCAGTGGTGGTGCATGTGATGAACTCCCACTTGCAAGGATCCGAATGAGCC
                      ____________________________________________________________
consensus GAAACGAAACCAGTGGTGGTGCATGTGATGAACTCCCACTTGCAAGGATCCGAATGAGCC
 
. : . : . : . : . : . :
JMFS016E03+ GGATTCCATGAAGAGAAGTGGCCGGCAGAAGAAGAAGAGTTGAAGGCAGAAAGCCATGAC
JMFS112C01+ GGATTCCATGAAGAGAAGTGGCCGGCAGAAGAAGAAGAGTTGAAGGCAGAAAGCCATGAC
JMFS022B04+ GGATTCCATGAAGAGAAGTGGCCGGCAGAAGAAGAAGAGTTGAAGGCAGAAAGCCATGAC
JMFS093C06+ GGATTCCATGAAGAGAAGTGGCCGGCAGAAGAAGAAGAGTTGAAGGCAGAAAGCCATGAC
JMFS166B06+ GGATTCCATGAAGAGAAGTGGCCGGCAGAAGAAGAAGAGTTGAAGGCAGAAAGCCATGAC
JMFS094C06+ GGATTCCATGAAGAGAAGTGGCCGGCAGAAGAAGAAGAGTTGAAGGCAGAAAGCCATGAC
JMFS142H02+ GGATTCCATGAAGAGAAGTGGCCGGCAGAAGAAGAAGAGTTGAAGGCAGAAAGCCATGAC
                      ____________________________________________________________
consensus GGATTCCATGAAGAGAAGTGGCCGGCAGAAGAAGAAGAGTTGAAGGCAGAAAGCCATGAC
 
. : . : . : . : . : . :
JMFS016E03+ AGTAAAGAGTGACCTTCCTGGTTCAAAGCCAAGATTGCAGGGAGAAACAA
JMFS112C01+ AGTAAAGAGTGACCTTCCTGGTTCAAAGCCAAGATTGCAGGGAGAAACAAGAGGAATATG
JMFS022B04+ AGTAAAGAGTGACCTTCCTGGTTCAAAGCCAAGATTGCAGGGAGAAACAAGAGGAATATG
JMFS093C06+ AGTAAAGAGTGACCTTCCTGGTTCAAAGCCAAGATTGCAGGGAGAAACAAGAGGAATATG
JMFS166B06+ AGTAAAGAGTGACCTTCCTGGTTCAAAGCCAAGATTGCAGGGAGAAACAAGAGGAATATG
JMFS094C06+ AGTAAAGAGTGACCTTCCTGGTTCAAAGCCAAGATTGCAGGGAGAAACAAGAGGAATATG
JMFS142H02+ AGTAAAGAGTGACCTTCCTGGTTCAAAGCCAAGATTGCAGGGAGAAACAAGAGGAATATG
                      ____________________________________________________________
consensus AGTAAAGAGTGACCTTCCTGGTTCAAAGCCAAGATTGCAGGGAGAAACAAGAGGAATATG
 
. : . : . : . : . : . :
JMFS112C01+ AAGACTGTTTTGGCAGAAGACATGATGATGATGAGGTATAAATGTCCTAATCAGCTTCTT
JMFS022B04+ AAGACTGTTTTGGCAGAAGACATGATGATGATGAGGTATAAATGTCCTAATCAGCTTCTT
JMFS093C06+ AAGACTGTTTTGGCAGAAGACATGATGATGATGAGGTATAAATGTCCTAATCAGCTTCTT
JMFS166B06+ AAGACTGTTTTGGCAGAAGACATGATGATGATGAGGTATAAATGTCCTAATCAGCTTCTT
JMFS094C06+ AAGACTGTTTTGGCAGAAGACATGATGATGATGAGGTATAAATGTCCTAATCAGCTTCTT
JMFS142H02+ AAGACTGTTTTGGCAGAAGACATGATGATGATGAGGTATAAATGTCCTAATCAGCTTCTT
                      ____________________________________________________________
consensus AAGACTGTTTTGGCAGAAGACATGATGATGATGAGGTATAAATGTCCTAATCAGCTTCTT
 
. : . : . : . : . : . :
JMFS112C01+ CTTCCTTCCAAGTGCAGTCATTAAAGTTCCCCAGCAATGA
JMFS022B04+ CTTCCTTCCAAGTGCAGTCATTAAAGTTCCCCAGCAATGATTTCTGCATCACATACAGTT
JMFS093C06+ CTTCCTTCCAAGTGCAGTCATTAAAGTTCCCCAGCAATGATTTCTGCATCACATACAGTT
JMFS166B06+ CTTCCTTCCAAGTGCAGTCATTAAAGTTCCCCAGCAATGATTTCTGCATCACATACAGTT
JMFS094C06+ CTTCCTTCCAAGTGCAGTCATTAAAGTTCCCCAGCAATGATTTCTGCATCACATACAGTT
JMFS142H02+ CTTCCTTCCAAGTGCAGTCATTAAAGTTCCCCAGCAATGATTTCTGCATCACATACAGTT
                      ____________________________________________________________
consensus CTTCCTTCCAAGTGCAGTCATTAAAGTTCCCCAGCAATGATTTCTGCATCACATACAGTT
 
. : . : . : . : . : . :
JMFS022B04+ TTCCAGAA
JMFS093C06+ TTCCAGAATCACTAAAAAACCAAGAAACTGAGTTCTAATTAAAACCCCAAATAATG-TTT
JMFS166B06+ TTCCAGAATCACTAAAAAACCAAGAAACTGAGTTCTAATTAAAACCCCAAATAATG-TTT
JMFS094C06+ TTCCAGAATCACTAAAAAACCAAGAAACTGAGTTCTAATTAAAACCCCAAATAATGTTTT
JMFS142H02+ TTCCAGAATCACTAAAAAACCAAGAAACTGAGTTCTAATTAAAACCCCAAATAATG-TTT
                      ____________________________________________________________
consensus TTCCAGAATCACTAAAAAACCAAGAAACTGAGTTCTAATTAAAACCCCAAATAATG-TTT
 
. : . : . : . : . : . :
JMFS093C06+ TTTTTTTTTCTCTTTAAACTAAGGA
JMFS166B06+ TTTTTTTTTCTCTTTAAACTAAGGATTTGATATTTGACAGTGTAGGACCGGATAAGTGAA
JMFS094C06+ TTTTTTTTTCTCTTTAAACTAAGGATTTGATATTTGACAGTGTAGGACCGGATAAGTGAA
JMFS142H02+ TTTTTTTTTCTCTTTAAACTAAGGATTTGATATTTGACAGTGTAGGACCGGATAAGTGAA
                      ____________________________________________________________
consensus TTTTTTTTTCTCTTTAAACTAAGGATTTGATATTTGACAGTGTAGGACCGGATAAGTGAA
 
. : . : . : . : . : . :
JMFS166B06+ TGAATGTGA
JMFS094C06+ TGAATGTGAGTAATGTAGAGTGAT
JMFS142H02+ TGAATGTGAGTAATGTAGAGTGATGGATAGGAAAATTATTGTTAAGAATGTACAAACATA
                      ____________________________________________________________
consensus TGAATGTGAGTAATGTAGAGTGATGGATAGGAAAATTATTGTTAAGAATGTACAAACATA
 
. : . : . : . : . : . :
JMFS142H02+ CCTTTGTTGTTGTGTATATATTGAATGGATAGTGTATGGGGTCGAGTTTTGGATGTTTTG
                      ____________________________________________________________
consensus CCTTTGTTGTTGTGTATATATTGAATGGATAGTGTATGGGGTCGAGTTTTGGATGTTTTG