Previous Contig 004054:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN006E17Sequence508004054 (2)gb:AC104711_17378125e-22Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1320_D10, complete s
JMFS141F04Sequence627004054 (2)gb:AC104711_17378124e-53Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1320_D10, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN006E17+ ATAAAAAATAGCTAGAGCATG
                      ____________________________________________________________
consensus ATAAAAAATAGCTAGAGCATG
 
. : . : . : . : . : . :
JMFN006E17+ GATATACTCCGTAATAATTATATAAATATGTTCTTTTACACCATTGAGATTTTTATTGAT
                      ____________________________________________________________
consensus GATATACTCCGTAATAATTATATAAATATGTTCTTTTACACCATTGAGATTTTTATTGAT
 
. : . : . : . : . : . :
JMFN006E17+ TATTTTTACAGACTATATATGGTATGGGCATGATGACTTGAGAACCAGAAACTTAACAGT
                      ____________________________________________________________
consensus TATTTTTACAGACTATATATGGTATGGGCATGATGACTTGAGAACCAGAAACTTAACAGT
 
. : . : . : . : . : . :
JMFN006E17+ GTTCAGAAACTCTCAAGAAAGTCACAGAGCCCAGTCCTCAACCTATCAGCAGGCTGTTCT
JMFS141F04+ GTCCTCAACCTATCAGCAGGCTGTTCT
                      ____________________________________________________________
consensus GTTCAGAAACTCTCAAGAAAGTCACAGAGCCCAGTCCTCAACCTATCAGCAGGCTGTTCT
 
. : . : . : . : . : . :
JMFN006E17+ CAAGCCATCTGAAACTGTACAATATTATACAACACATTCTGGTGAACAAATAATGAGGCT
JMFS141F04+ CAAGCCATCTGAAACTGTACAATATTATACAACACATTCTGGTGAACAAATAATGAGGCT
                      ____________________________________________________________
consensus CAAGCCATCTGAAACTGTACAATATTATACAACACATTCTGGTGAACAAATAATGAGGCT
 
. : . : . : . : . : . :
JMFN006E17+ TCAGAATCCACACCTTCTTTCTTCTCCTGTGTTACTCAAAGCATTTTCATTATCCAAAGC
JMFS141F04+ TCAGAATCCACACCTTCTTTCTTCTCCTGTGTTACTCAAAGCATTTTCATTATCCAAAGC
                      ____________________________________________________________
consensus TCAGAATCCACACCTTCTTTCTTCTCCTGTGTTACTCAAAGCATTTTCATTATCCAAAGC
 
. : . : . : . : . : . :
JMFN006E17+ CTGTGTTTCTTTATATACAGATAAACGAGGCATGGGCCAATCAATTCTGCGTCTGAGAGG
JMFS141F04+ CTGTGTTTCTTTATATACAGATAAACGAGGCATGGGCCAATCAATTCTGCGTCTGAGAGG
                      ____________________________________________________________
consensus CTGTGTTTCTTTATATACAGATAAACGAGGCATGGGCCAATCAATTCTGCGTCTGAGAGG
 
. : . : . : . : . : . :
JMFN006E17+ CGTTTGCAGAGGTTGAGATAAGTCTCAAGCCCTCCCGACTGTTGGATGCTTCGTCTTAGT
JMFS141F04+ CGTTTGCAGAGGTTGAGATAAGTCTCAAGCCCTCCCGACTGTTGGATGCTTCGTCTTAGT
                      ____________________________________________________________
consensus CGTTTGCAGAGGTTGAGATAAGTCTCAAGCCCTCCCGACTGTTGGATGCTTCGTCTTAGT
 
. : . : . : . : . : . :
JMFN006E17+ CCCTGAAGGACAGCCGCTCTGTCCAGAAACTGCGGGTGCAGACCCAAGTCGAGCATTTTC
JMFS141F04+ CCCTGAAGGACAGCCGCTCTGTCCAGAAACTGCGGGTGCAGACCCAAGTCGAGCATTTTC
                      ____________________________________________________________
consensus CCCTGAAGGACAGCCGCTCTGTCCAGAAACTGCGGGTGCAGACCCAAGTCGAGCATTTTC
 
. : . : . : . : . : . :
JMFN006E17+ GTTAGTG
JMFS141F04+ GTTAGTGTTTCTGCAGCATTCTCGAAATGCCCGCCTTTGATGTAGCCTCTCATCAGCCAC
                      ____________________________________________________________
consensus GTTAGTGTTTCTGCAGCATTCTCGAAATGCCCGCCTTTGATGTAGCCTCTCATCAGCCAC
 
. : . : . : . : . : . :
JMFS141F04+ GACAGAGTTTTTTTCTTCTGAAGAGAACTCGATGTCTCCATTCTGGTGAGTAGTCTTCCT
                      ____________________________________________________________
consensus GACAGAGTTTTTTTCTTCTGAAGAGAACTCGATGTCTCCATTCTGGTGAGTAGTCTTCCT
 
. : . : . : . : . : . :
JMFS141F04+ ATGGCGCCCGCTTCCTTTTGGGAGGCGCATATAGCTAATACAATGTCGTAAAGGTCTCGG
                      ____________________________________________________________
consensus ATGGCGCCCGCTTCCTTTTGGGAGGCGCATATAGCTAATACAATGTCGTAAAGGTCTCGG
 
. : . : . : . : . : . :
JMFS141F04+ TTAACTTCTTTACCAATAAGCTTCATTTGCCACAAGTGTCTCTCGGCCTCGACTCCATGG
                      ____________________________________________________________
consensus TTAACTTCTTTACCAATAAGCTTCATTTGCCACAAGTGTCTCTCGGCCTCGACTCCATGG
 
. : . : . : . : . : . :
JMFS141F04+ CCCGAGCATATGTACATTGCAAGAAGCCTCTCGTGAACCACCCCGTAGAGGGATGGACCG
                      ____________________________________________________________
consensus CCCGAGCATATGTACATTGCAAGAAGCCTCTCGTGAACCACCCCGTAGAGGGATGGACCG