Previous Contig 004048:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS076A04Sequence642004048 (3)pir|T09846|T098462e-73phosphoenolpyruvate carboxylase (EC 4.1.1.31) 1 - upland cotton>gb:AF008939_1761
JMFS085G02Sequence615004048 (3)pir|T09846|T098466e-69phosphoenolpyruvate carboxylase (EC 4.1.1.31) 1 - upland cotton>gb:AF008939_1761
JMFS140E02Sequence623004048 (3)pir|T09846|T098462e-69phosphoenolpyruvate carboxylase (EC 4.1.1.31) 1 - upland cotton>gb:AF008939_1761

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS085G02+ CTCATCGAGCTCCTGCTTAT
JMFS076A04+ AGCTGCCTGTATCTCTCTCTGTAGAGCCTCATCGAGCTCCTGCTTAT
JMFS140E02+ AGCCTCATCGAGCTCCTGCTTAT
                      ____________________________________________________________
consensus AGCTGCCTGTATCTCTCTCTGTAGAGCCTCATCGAGCTCCTGCTTAT
 
. : . : . : . : . : . :
JMFS085G02+ CATCAGGAGTGATGTCTTTAGCATACAACTGAGTCAAACAATCCCGAATCCTTGCATGTT
JMFS076A04+ CATCAGGAGTGATGTCTTTAGCATACAACTGAGTCAAACAATCCCGAATCCTTGCATGTT
JMFS140E02+ CATCAGGAGTGATGTCTTTAGCATACAACTGAGTCAAACAATCCCGAATCCTTGCATGTT
                      ____________________________________________________________
consensus CATCAGGAGTGATGTCTTTAGCATACAACTGAGTCAAACAATCCCGAATCCTTGCATGTT
 
. : . : . : . : . : . :
JMFS085G02+ TTTGAAGCAAAGATCTACGAACAGACTGAGTAGGATGGGCGGTGAGCACAAGATCAACTG
JMFS076A04+ TTTGAAGCAAAGATCTACGAACAGACTGAGTAGGATGGGCGGTGAGCACAAGATCAACTG
JMFS140E02+ TTTGAAGCAAAGATCTACGAACAGACTGAGTAGGATGGGCGGTGAGCACAAGATCAACTG
                      ____________________________________________________________
consensus TTTGAAGCAAAGATCTACGAACAGACTGAGTAGGATGGGCGGTGAGCACAAGATCAACTG
 
. : . : . : . : . : . :
JMFS085G02+ TCTGGTTCTTTATAGCATCAAACACTTCTTCGGGGGACTTATTCAGTTGTCCTACAAGCC
JMFS076A04+ TCTGGTTCTTTATAGCATCAAACACTTCTTCGGGGGACTTATTCAGTTGTCCTACAAGCC
JMFS140E02+ TCTGGTTCTTTATAGCATCAAACACTTCTTCGGGGGACTTATTCAGTTGTCCTACAAGCC
                      ____________________________________________________________
consensus TCTGGTTCTTTATAGCATCAAACACTTCTTCGGGGGACTTATTCAGTTGTCCTACAAGCC
 
. : . : . : . : . : . :
JMFS085G02+ TCCTAAGAGTCTCTTCGATGTCCGATTCAGTTGTGGCAGACGCCTCATCAGACAAATCAC
JMFS076A04+ TCCTAAGAGTCTCTTCGATGTCCGATTCAGTTGTGGCAGACGCCTCATCAGACAAATCAC
JMFS140E02+ TCCTAAGAGTCTCTTCGATGTCCGATTCAGTTGTGGCAGACGCCTCATCAGACAAATCAC
                      ____________________________________________________________
consensus TCCTAAGAGTCTCTTCGATGTCCGATTCAGTTGTGGCAGACGCCTCATCAGACAAATCAC
 
. : . : . : . : . : . :
JMFS085G02+ GCTTCTTGAACTTACTCCTCCGCCTCGAGGCTATCTGAACCTCTTCAGCCAGATTGGCTA
JMFS076A04+ GCTTCTTGAACTTACTCCTCCGCCTCGAGGCTATCTGAACCTCTTCAGCCAGATTGGCTA
JMFS140E02+ GCTTCTTGAACTTACTCCTCCGCCTCGAGGCTATCTGAACCTCTTCAGCCAGATTGGCTA
                      ____________________________________________________________
consensus GCTTCTTGAACTTACTCCTCCGCCTCGAGGCTATCTGAACCTCTTCAGCCAGATTGGCTA
 
. : . : . : . : . : . :
JMFS085G02+ AGTTAAGCATATTGGAAAACGCTTTGGTAACCACAATGGAATTCCCGGGATCCAGACTAG
JMFS076A04+ AGTTAAGCATATTGGAAAACGCTTTGGTAACCACAATGGAATTCCCGGGATCCAGACTAG
JMFS140E02+ AGTTAAGCATATTGGAAAACGCTTTGGTAACCACAATGGAATTCCCGGGATCCAGACTAG
                      ____________________________________________________________
consensus AGTTAAGCATATTGGAAAACGCTTTGGTAACCACAATGGAATTCCCGGGATCCAGACTAG
 
. : . : . : . : . : . :
JMFS085G02+ TAATCACCCTCCCAAGCTCCTCTAGTTTCTGGGTATCTTGCTTCCCTTCATATTCTGCTG
JMFS076A04+ TAATCACCCTCCCAAGCTCCTCTAGTTTCTGGGTATCTTGCTTCCCTTCATATTCTGCTG
JMFS140E02+ TAATCACCCTCCCAAGCTCCTCTAGTTTCTGGGTATCTTGCTTCCCTTCATATTCTGCTG
                      ____________________________________________________________
consensus TAATCACCCTCCCAAGCTCCTCTAGTTTCTGGGTATCTTGCTTCCCTTCATATTCTGCTG
 
. : . : . : . : . : . :
JMFS085G02+ AAAGCTCATA
JMFS076A04+ AAAGCTCATA
JMFS140E02+ AAAGCTCATAGCATTCTTGAACCTAGTGGAAATTCAACCAGTTTACAGTCATGACAGATG
                      ____________________________________________________________
consensus AAAGCTCATAGCATTCTTGAACCTAGTGGAAATTCAACCAGTTTACAGTCATGACAGATG
 
. : . : . : . : . : . :
JMFS140E02+ CTTTTGTGTGATATATTTAGTTAAAATTCTATTGATGATGAGCGGGCAAAAGCCCCCAGA
                      ____________________________________________________________
consensus CTTTTGTGTGATATATTTAGTTAAAATTCTATTGATGATGAGCGGGCAAAAGCCCCCAGA
 
. : . : . : . : . : . :
JMFS140E02+ TCCCCCGGTTTGTGAGCCAGGTTCCCCCCTTCTTTTTTCTTGGCACGAGATGCCGTTACA
                      ____________________________________________________________
consensus TCCCCCGGTTTGTGAGCCAGGTTCCCCCCTTCTTTTTTCTTGGCACGAGATGCCGTTACA