Previous Contig 004041:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS140A03Sequence571004041 (2)pir|B84520|B845208e-49hypothetical protein At2g14680 [imported] - Arabidopsis thaliana>gb:AC005398_153
JMSF043J12Sequence775004041 (2)pir|B84520|B845201e-60hypothetical protein At2g14680 [imported] - Arabidopsis thaliana>gb:AC005398_153722024043gb:AK118833_18167913e-36Arabidopsis thaliana At2g14680 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043J12+ GTCATGCAGGAGACACTCAC
                      ____________________________________________________________
consensus GTCATGCAGGAGACACTCAC
 
. : . : . : . : . : . :
JMSF043J12+ ATTTGTCTTCCAAGCACGTATCCTTAATATCATCCAAAGCATGTTGTCTAATGTCATAAA
                      ____________________________________________________________
consensus ATTTGTCTTCCAAGCACGTATCCTTAATATCATCCAAAGCATGTTGTCTAATGTCATAAA
 
. : . : . : . : . : . :
JMSF043J12+ ATTTATTAACAACCTCTCTGAAAACCTCCAGCTGCTTTGATTGCTTTTCTAGGTCACTCT
                      ____________________________________________________________
consensus ATTTATTAACAACCTCTCTGAAAACCTCCAGCTGCTTTGATTGCTTTTCTAGGTCACTCT
 
. : . : . : . : . : . :
JMSF043J12+ GTAGAGTGGCAGTGAGTGCTTTTTCCTCAAGCAATTCACAGCTAATCTTTTCAAATCTTT
                      ____________________________________________________________
consensus GTAGAGTGGCAGTGAGTGCTTTTTCCTCAAGCAATTCACAGCTAATCTTTTCAAATCTTT
 
. : . : . : . : . : . :
JMSF043J12+ CCTGAAGTGGATAGAATTCTCTTGAATTAAACTCCTCCTG-TTCCTTTGCTTTCTCAGCC
JMFS140A03+ AACTCCTCCTGTTTCCTTTGCTTTCTCAGCC
                      ____________________________________________________________
consensus CCTGAAGTGGATAGAATTCTCTTGAATTAAACTCCTCCTGTTTCCTTTGCTTTCTCAGCC
 
. : . : . : . : . : . :
JMSF043J12+ TCCATTACAGCATTGTCCCGCTCAGCAAATGCAGAAGCAACACAACCCTGAAAGAACTTA
JMFS140A03+ TCCATTACAGCATTGTCCCGCTCAGCAAATGCAGAAGCAACACAACCCTGAAAGAACTTA
                      ____________________________________________________________
consensus TCCATTACAGCATTGTCCCGCTCAGCAAATGCAGAAGCAACACAACCCTGAAAGAACTTA
 
. : . : . : . : . : . :
JMSF043J12+ AGCTGTTTTTCTGCTTCAATGTTCTTGGAGACTTCTGCACTATGTAAATCTGCTAGCTGA
JMFS140A03+ AGCTGTTTTTCTGCTTCAATGTTCTTGGAGACTTCTGCACTATGTAAATCTGCTAGCTGA
                      ____________________________________________________________
consensus AGCTGTTTTTCTGCTTCAATGTTCTTGGAGACTTCTGCACTATGTAAATCTGCTAGCTGA
 
. : . : . : . : . : . :
JMSF043J12+ CTCTTGACATGATAGGCTTCTGAAAGCTCCTCTTGAAGATTTTGATTTTCTCTAGTGCAA
JMFS140A03+ CTCTTGACATGATAGGCTTCTGAAAGCTCCTCTTGAAGATTTTGATTTTCTCTAGTGCAA
                      ____________________________________________________________
consensus CTCTTGACATGATAGGCTTCTGAAAGCTCCTCTTGAAGATTTTGATTTTCTCTAGTGCAA
 
. : . : . : . : . : . :
JMSF043J12+ GCAGCTAACTTCTTTTTTAAGTTTTCAATCTCTTGCTCCAACGCAGCTGTCCTGTGAAGG
JMFS140A03+ GCAGCTAACTTCTTTTTTAAGTTTTCAATCTCTTGCTCCAACGCAGCTGTCCTGTGAAGG
                      ____________________________________________________________
consensus GCAGCTAACTTCTTTTTTAAGTTTTCAATCTCTTGCTCCAACGCAGCTGTCCTGTGAAGG
 
. : . : . : . : . : . :
JMSF043J12+ TGCATACGAGTAGCCACACCTAGATAGGCAGGTCCGGCTTGTTGCATGCATAGCTGTTCA
JMFS140A03+ TGCATACGAGTAGCCACACCTAGATAGGCAGGTCCGGCTTGTTGCATGCATAGCTGTTCA
                      ____________________________________________________________
consensus TGCATACGAGTAGCCACACCTAGATAGGCAGGTCCGGCTTGTTGCATGCATAGCTGTTCA
 
. : . : . : . : . : . :
JMSF043J12+ ATGTCTTTATGCAAGTCATCCCGCTCACGCTCCAACTGCTGAATACGAGCATGAAAGGCT
JMFS140A03+ ATGTCTTTATGCAAGTCATCCCGCTCACGCTCCAACTGCTGAATACGAGCATGAAAGGCT
                      ____________________________________________________________
consensus ATGTCTTTATGCAAGTCATCCCGCTCACGCTCCAACTGCTGAATACGAGCATGAAAGGCT
 
. : . : . : . : . : . :
JMSF043J12+ GTATTGTCTTCCAAATTTCCTTCCATAGCTGAAACTCTGGGAATGGTAGCAGAACGAAAA
JMFS140A03+ GTATTGTCTTCCAAATTTCCTTCCATAGCTGAAACTCTGGGAATGGTAGCAGAACGAAAA
                      ____________________________________________________________
consensus GTATTGTCTTCCAAATTTCCTTCCATAGCTGAAACTCTGGGAATGGTAGCAGAACGAAAA
 
. : . : . : . : . : . :
JMSF043J12+ TTCGGAAACGATGGGGCAGGAGAGGGGGTATTGATTGTGTGTAGTTAATCCCCTCCGCCC
JMFS140A03+ TTCGGAAACGATGGGGCAGGAGAGGGGGTATTGATTGTGTGTAGTTAATCCCCTCCGCCC
                      ____________________________________________________________
consensus TTCGGAAACGATGGGGCAGGAGAGGGGGTATTGATTGTGTGTAGTTAATCCCCTCCGCCC
 
. : . : . : . : . : . :
JMSF043J12+ AATGATTGCTTAAACCGGAAGAGCTGCTCTCTTCC
JMFS140A03+ AATGATTGCTTAAACCGGAAGAGCTGCTCTCTTCCTTCCCAAGTCTACTTTCCTGTCCCG
                      ____________________________________________________________
consensus AATGATTGCTTAAACCGGAAGAGCTGCTCTCTTCCTTCCCAAGTCTACTTTCCTGTCCCG