Previous Contig 004039:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030N12Sequence562001403 (2)728004039 (2)gb:AY506804_16100156e-60Capsella bursa-pastoris inducer of CBF expression 1 protein (ice53) mRNA, comple
JMFS139H04Sequence575004039 (2)gb:AY506804_16100154e-30Capsella bursa-pastoris inducer of CBF expression 1 protein (ice53) mRNA, comple

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF030N12+ GCAAGGGTTGAAGTAAG
JMFS139H04+ AGTCCAACTGGACAGCCTGCAAGGGTTGAAGTAAG
                      ____________________________________________________________
consensus AGTCCAACTGGACAGCCTGCAAGGGTTGAAGTAAG
 
. : . : . : . : . : . :
rJMFF030N12+ GGTTAGAGAAGGAAGAGCGGTGAACATCCATATGTTTTGTAGCCGCAAACCCGGGCTATT
JMFS139H04+ GGTTAGAGAAGGAAGAGCGGTGAACATCCATATGTTTTGTAGCCGCAAACCCGGGCTATT
                      ____________________________________________________________
consensus GGTTAGAGAAGGAAGAGCGGTGAACATCCATATGTTTTGTAGCCGCAAACCCGGGCTATT
 
. : . : . : . : . : . :
rJMFF030N12+ ACTTTCAACGATGAAGGCTCTTGACAACCTTGGTATAGACATCCAACAGGCTGTTATCAG
JMFS139H04+ ACTTTCAACGATGAAGGCTCTTGACAACCTTGGTATAGACATCCAACAGGCTGTTATCAG
                      ____________________________________________________________
consensus ACTTTCAACGATGAAGGCTCTTGACAACCTTGGTATAGACATCCAACAGGCTGTTATCAG
 
. : . : . : . : . : . :
rJMFF030N12+ CTGCTTCAACGGGTTTGCGTTGGATATTTTCCGAGCAGAGCAATGCAAGGAAGGCCAAGA
JMFS139H04+ CTGCTTCAACGGGTTTGCGTTGGATATTTTCCGAGCAGAGCAATGCAAGGAAGGCCAAGA
                      ____________________________________________________________
consensus CTGCTTCAACGGGTTTGCGTTGGATATTTTCCGAGCAGAGCAATGCAAGGAAGGCCAAGA
 
. : . : . : . : . : . :
rJMFF030N12+ CATCCATCCAGATCAAATCAAAGCTGTACTTATGGACTCCGCTAGCTTCAACGGGATGAT
JMFS139H04+ CATCCATCCAGATCAAATCAAAGCTGTACTTATGGACTCCGCTAGCTTCAACGGGATGAT
                      ____________________________________________________________
consensus CATCCATCCAGATCAAATCAAAGCTGTACTTATGGACTCCGCTAGCTTCAACGGGATGAT
 
. : . : . : . : . : . :
rJMFF030N12+ CTAAGCTGTACTCAAGGTCACGGTTTTCAATGTCGTTATTCAGATCAACTTTGCAGTCCT
JMFS139H04+ CTAAGCTGTACTCAAGGTCACGGTTTTCAATGTCGTTATTCAGATCAACTTTGCAGTCCT
                      ____________________________________________________________
consensus CTAAGCTGTACTCAAGGTCACGGTTTTCAATGTCGTTATTCAGATCAACTTTGCAGTCCT
 
. : . : . : . : . : . :
rJMFF030N12+ CCTGATATGCATCACTCGTAGCAGATAATGTCGTCCTCGTAAGTCATAACCTTTGGAATT
JMFS139H04+ CCTGATATGCATCACTCGTAGCAGATAATGTCGTCCTCGTAAGTCATAACCTTTGGAATT
                      ____________________________________________________________
consensus CCTGATATGCATCACTCGTAGCAGATAATGTCGTCCTCGTAAGTCATAACCTTTGGAATT
 
. : . : . : . : . : . :
rJMFF030N12+ TCAATATTTCGGATTAGTTTAGCATTAAGCATGGCGTTGTTTTGTATTTTGCCCCCGGAA
JMFS139H04+ TCAATATTTCGGATTAGTTTAGCATTAAGCATGGCGTTGTTTTGTATTTTGCCCCCGGAA
                      ____________________________________________________________
consensus TCAATATTTCGGATTAGTTTAGCATTAAGCATGGCGTTGTTTTGTATTTTGCCCCCGGAA
 
. : . : . : . : . : . :
rJMFF030N12+ GAAACACCGTTATTTTGCTTTGTAGTTCTGCAAAC-GAATGCAGAG
JMFS139H04+ GAAACACCGTTATTTTGCTTTGTAGTTCTGCAAACTGAATGCAGAGATTTTACCATTCCA
                      ____________________________________________________________
consensus GAAACACCGTTATTTTGCTTTGTAGTTCTGCAAACTGAATGCAGAGATTTTACCATTCCA
 
. : . : . : . : . : . :
JMFS139H04+ ACCTGGTTTCAAGTTTGCTCTCTTACATTCTATATATATTATGGTTATTTGACTATAGAG
                      ____________________________________________________________
consensus ACCTGGTTTCAAGTTTGCTCTCTTACATTCTATATATATTATGGTTATTTGACTATAGAG