Previous Contig 004036:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS139D01Sequence564004036 (2)gb:AF014806_17613581e-19Arabidopsis thaliana alpha-glucosidase 1 (Aglu1) gene, complete cds.
JMSF019B23Sequence245004036 (2)sp|O04893|AGLU_SPIOL6e-06Alpha-glucosidase precursor (EC 3.2.1.20) (Maltase).>pir|T09143|T09143 alpha-glu781022856sp|O04893|AGLU_SPIOL5e-52Alpha-glucosidase precursor (EC 3.2.1.20) (Maltase).>pir|T09143|T09143 alpha-glu

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS139D01+ CCGATCAACGGTTGGAAGGCTTCC
                      ____________________________________________________________
consensus CCGATCAACGGTTGGAAGGCTTCC
 
. : . : . : . : . : . :
JMFS139D01+ GCCTCCGGCGGCGGTTGTTGGCGGGGGATGACGTCATGTGGAACCTCCCATCTCTGGTTG
                      ____________________________________________________________
consensus GCCTCCGGCGGCGGTTGTTGGCGGGGGATGACGTCATGTGGAACCTCCCATCTCTGGTTG
 
. : . : . : . : . : . :
JMFS139D01+ TTAGCGTCCGTTATTCGGACTCTCAGACGCTCGCTTGTTTCAAAGCTGGCGACAAGGTTG
                      ____________________________________________________________
consensus TTAGCGTCCGTTATTCGGACTCTCAGACGCTCGCTTGTTTCAAAGCTGGCGACAAGGTTG
 
. : . : . : . : . : . :
JMSF019B23+ ATCAGGTCCAAAAACAGAGGATTTTTTGATGAGCTGAAGCTTAGCAGTG
JMFS139D01+ AGTGAGGGAATATCAGGTCCAAAAACAGAGGATTTTTTGATGAGCTGAAGCTTAGCAGTG
                      ____________________________________________________________
consensus AGTGAGGGAATATCAGGTCCAAAAACAGAGGATTTTTTGATGAGCTGAAGCTTAGCAGTG
 
. : . : . : . : . : . :
JMSF019B23+ AGAGAAGTTGCAGTGGAATCTGCGCCAACTGAAATAACTTTGTAACCATATCCGATAACG
JMFS139D01+ AGAGAAGTTGCAGTGGAATCTGCGCCAACTGAAATAACTTTGTAACCATATCCGATAACG
                      ____________________________________________________________
consensus AGAGAAGTTGCAGTGGAATCTGCGCCAACTGAAATAACTTTGTAACCATATCCGATAACG
 
. : . : . : . : . : . :
JMSF019B23+ CCTTCCTCGCCCTTGTTTTCTTCCGGAAAAGACGAGGCCGACGCGTCGGAGAAGTGGACG
JMFS139D01+ CCTTCCTCGCCCTTGTTTTCTTCCGGAAAAGACGAGGCCGACGCGTCGGAGAAGTGGACG
                      ____________________________________________________________
consensus CCTTCCTCGCCCTTGTTTTCTTCCGGAAAAGACGAGGCCGACGCGTCGGAGAAGTGGACG
 
. : . : . : . : . : . :
JMSF019B23+ AGCCACAGAAGAAGCGCAACTGCTAGTGCCGCCGGAGAACGCAGTCTCGCCGTCGTCATG
JMFS139D01+ AGCCACAGAAGAAGCGCAACTGCTAGTGCCGCCGGAGAACGCAGTCTCGCCGTCGTCATG
                      ____________________________________________________________
consensus AGCCACAGAAGAAGCGCAACTGCTAGTGCCGCCGGAGAACGCAGTCTCGCCGTCGTCATG
 
. : . : . : . : . : . :
JMSF019B23+ GCCTGGGGCTCTT
JMFS139D01+ GCCTGGGGCTCTTGTACAGATCCAGAGTCTCGATAGAGTAATTCTCXXXXXXXXXXXXXX
                      ____________________________________________________________
consensus GCCTGGGGCTCTTGTACAGATCCAGAGTCTCGATAGAGTAATTCTCNNNNNNNNNNNNNN
 
. : . : . : . : . : . :
JMFS139D01+ XXXXXXXXXXXXGTCTCGATAGAGTAGCTTTGGAAATGGAGCTCAACAGGTCAATATCAC
                      ____________________________________________________________
consensus NNNNNNNNNNNNGTCTCGATAGAGTAGCTTTGGAAATGGAGCTCAACAGGTCAATATCAC
 
. : . : . : . : . : . :
JMFS139D01+ CATTTCTACACCTTTTTTTTACTCTGCTTTTGTGTCAAGTAGGAAGACCACAAAACGTAA
                      ____________________________________________________________
consensus CATTTCTACACCTTTTTTTTACTCTGCTTTTGTGTCAAGTAGGAAGACCACAAAACGTAA