Previous Contig 004027:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028L17Sequence320004027 (2)pir|T05335|T053351e-10hypothetical protein F1C12.190 - Arabidopsis thaliana>gb:ATCHRIV52_1545865 Arabi678021300pir|T05335|T053352e-64hypothetical protein F1C12.190 - Arabidopsis thaliana>gb:ATCHRIV52_1545865 Arabi
JMFS138F08Sequence635004027 (2)pir|T05335|T053353e-31hypothetical protein F1C12.190 - Arabidopsis thaliana>gb:ATCHRIV52_1545865 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS138F08+ AGCGGGCACGAGAAGTTGTTGTCATAAGCATCCAG
                      ____________________________________________________________
consensus AGCGGGCACGAGAAGTTGTTGTCATAAGCATCCAG
 
. : . : . : . : . : . :
JMFS138F08+ AACTTGAAGCTCCGGCAGACCGGAGAAATCCCAGTCCAGACATCCACTGAACAGGTTGTT
                      ____________________________________________________________
consensus AACTTGAAGCTCCGGCAGACCGGAGAAATCCCAGTCCAGACATCCACTGAACAGGTTGTT
 
. : . : . : . : . : . :
JMFS138F08+ TGATATGTTGAGGAATCTGAGACCAGAAATGTTTGATAGTGGGAGATCCCCAAACAGGCT
                      ____________________________________________________________
consensus TGATATGTTGAGGAATCTGAGACCAGAAATGTTTGATAGTGGGAGATCCCCAAACAGGCT
 
. : . : . : . : . : . :
JMFS138F08+ GTTCCCTGCCACCGACAAATTCACCAAACTCTGAAGCTCAGATATGGCAGGCGACAGAGG
                      ____________________________________________________________
consensus GTTCCCTGCCACCGACAAATTCACCAAACTCTGAAGCTCAGATATGGCAGGCGACAGAGG
 
. : . : . : . : . : . :
JMFF028L17+ CTGATTTGTTGTACGCGTCGCA
JMFS138F08+ ACCAGAGAGGTTCAAGTTGGAAACATCTAACGAAACTACTGATTTGTTGTACGCGTCGCA
                      ____________________________________________________________
consensus ACCAGAGAGGTTCAAGTTGGAAACATCTAACGAAACTACTGATTTGTTGTACGCGTCGCA
 
. : . : . : . : . : . :
JMFF028L17+ TGTCACGCCTGTCCAATTACATAGTCCCATGTAATTCGAGAGATTCCAGGTAGACAGACT
JMFS138F08+ TGTCACGCCTGTCCAATTACATAGTCCCATGTAATTCGAGAGATTCCAGGTAGACAGACT
                      ____________________________________________________________
consensus TGTCACGCCTGTCCAATTACATAGTCCCATGTAATTCGAGAGATTCCAGGTAGACAGACT
 
. : . : . : . : . : . :
JMFF028L17+ AGGATCCGGGGCTTGAAAACTCTGTTTTACAGAAACCAGAACCGCAGCTTGTCTTCTTGC
JMFS138F08+ AGGATCCGGGGCTTGAAAACTCTGTTTTACAGAAACCAGAACCGCAGCTTGTCTTCTTGC
                      ____________________________________________________________
consensus AGGATCCGGGGCTTGAAAACTCTGTTTTACAGAAACCAGAACCGCAGCTTGTCTTCTTGC
 
. : . : . : . : . : . :
JMFF028L17+ AGAAAGACTGTCATGGGCTGAGGTGAGAAAAACAAGAAAGAAGAAGAAGAAGAGTAGGCG
JMFS138F08+ AGAAAGACTGTCATGGGCTGAGGTGAGAAAAACAAGAAAGAAGAAGAAGAAGAGTAGGCG
                      ____________________________________________________________
consensus AGAAAGACTGTCATGGGCTGAGGTGAGAAAAACAAGAAAGAAGAAGAAGAAGAGTAGGCG
 
. : . : . : . : . : . :
JMFF028L17+ CAGAGTGAGAGCAGCCATGTGGAAGATGAAAACTGAGAAAGAAAATGGGTTTTTGGTATC
JMFS138F08+ CAGAGTGAGAGCAGCCATGTGGAAGATGAAAACTGAGAAAGAAAATGGGTTTTTGGTATC
                      ____________________________________________________________
consensus CAGAGTGAGAGCAGCCATGTGGAAGATGAAAACTGAGAAAGAAAATGGGTTTTTGGTATC
 
. : . : . : . : . : . :
JMFF028L17+ AGAAATATTGAAGAAGAAGAAGAAGAAGAAGAAAAGAAGCAGGTTTTTCTGGGTTGAT
JMFS138F08+ AGAAATATTGAAGAAGAAGAAGAAGAAGAAGAAAAGAAGCAGGTTTTTCTGGGTTGATGA
                      ____________________________________________________________
consensus AGAAATATTGAAGAAGAAGAAGAAGAAGAAGAAAAGAAGCAGGTTTTTCTGGGTTGATGA
 
. : . : . : . : . : . :
JMFS138F08+ AGTAGAATTGGTGCATTGATGAGGTTATCTGATGATAATAGCAGAAGAATTAAAAGCAAG
                      ____________________________________________________________
consensus AGTAGAATTGGTGCATTGATGAGGTTATCTGATGATAATAGCAGAAGAATTAAAAGCAAG