Previous Contig 004006:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS090G09Sequence623004006 (2)pir|T10636|T106366e-09hypothetical protein T13K14.100 - Arabidopsis thaliana>gb:ATCHRIV54_1545932 Arab
JMFS136E06Sequence612004006 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS090G09+ AGGCAGGGCAGGCATTTGAGTCAGTGGAATTCTCATTCCAGGACTGAAGCACATAG
                      ____________________________________________________________
consensus AGGCAGGGCAGGCATTTGAGTCAGTGGAATTCTCATTCCAGGACTGAAGCACATAG
 
. : . : . : . : . : . :
JMFS090G09+ CCAGTAGGGTCATACCTGATCCATTTCTTAAATTCAAGCAGCACAGAAACATCTTGGGAT
                      ____________________________________________________________
consensus CCAGTAGGGTCATACCTGATCCATTTCTTAAATTCAAGCAGCACAGAAACATCTTGGGAT
 
. : . : . : . : . : . :
JMFS090G09+ ATGAACTGCCCCAGGGCAAACCCAAAGTAAATGGAAAAGGTTATAATAAGTCTAATAAGC
                      ____________________________________________________________
consensus ATGAACTGCCCCAGGGCAAACCCAAAGTAAATGGAAAAGGTTATAATAAGTCTAATAAGC
 
. : . : . : . : . : . :
JMFS090G09+ TTCATCCCAGCCCCAATTTCCTATAATAATGCCTTCACTCTCACCAACATTTAAACTCAA
JMFS136E06+ CACCAACATTTAAACTCAA
                      ____________________________________________________________
consensus TTCATCCCAGCCCCAATTTCCTATAATAATGCCTTCACTCTCACCAACATTTAAACTCAA
 
. : . : . : . : . : . :
JMFS090G09+ TCATAAGATATGCCAAGAACAACTTGTGGGCAGGCTTTCATTCATATGAAAACATTCAAT
JMFS136E06+ TCATAAGATATGCCAAGAACAACTTGTGGGCAGGCTTTCATTCATATGAAAACATTCAAT
                      ____________________________________________________________
consensus TCATAAGATATGCCAAGAACAACTTGTGGGCAGGCTTTCATTCATATGAAAACATTCAAT
 
. : . : . : . : . : . :
JMFS090G09+ GATCTAAAGGACCAAAGTTAAGCAGAGCAGAAGTAAAGCATATCTTGACAGCTCTGGAAA
JMFS136E06+ GATCTAAAGGACCAAAGTTAAGCAGAGCAGAAGTAAAGCATATCTTGACAGCTCTGGAAA
                      ____________________________________________________________
consensus GATCTAAAGGACCAAAGTTAAGCAGAGCAGAAGTAAAGCATATCTTGACAGCTCTGGAAA
 
. : . : . : . : . : . :
JMFS090G09+ CACCCAAACCTCCATGAACTCAAAACAATTAAACAAGAAGGCCTCAAAATGTTAATTTTG
JMFS136E06+ CACCCAAACCTCCATGAACTCAAAACAATTAAACAAGAAGGCCTCAAAATGTTAAT----
                      ____________________________________________________________
consensus CACCCAAACCTCCATGAACTCAAAACAATTAAACAAGAAGGCCTCAAAATGTTAATTTTG
 
. : . : . : . : . : . :
JMFS090G09+ TACCCCAGGAAAAAGTGAGGCAGATTGGTCTCTAAATCTGCAATAAATGCCGCGGAAACA
JMFS136E06+ ---CCCAGGAAAAAGTGAGGCAGATTGGTCTCTAAATCTGCAATAAATGCCGCGGAAACA
                      ____________________________________________________________
consensus TACCCCAGGAAAAAGTGAGGCAGATTGGTCTCTAAATCTGCAATAAATGCCGCGGAAACA
 
. : . : . : . : . : . :
JMFS090G09+ AATGGACGTGGAAAAGCTTGGTCCTTTGGAAAACCCCTCCTTTCCCTTGCCCATTCATCT
JMFS136E06+ AATGGACGTGGAAAAGCTTGGTCCTTTGGAAAACCCCTCCTTTCCCTTGCCCATTCATCT
                      ____________________________________________________________
consensus AATGGACGTGGAAAAGCTTGGTCCTTTGGAAAACCCCTCCTTTCCCTTGCCCATTCATCT
 
. : . : . : . : . : . :
JMFS090G09+ GCATATGATATGATTCTTGCGCGAAATTTCTCTCTCTACAATTATCACACTCACACTCTA
JMFS136E06+ GCATATGATATGATTCTTGCGCGAAATTTCTCTCTCTACAATTATCACACTCACACTCTA
                      ____________________________________________________________
consensus GCATATGATATGATTCTTGCGCGAAATTTCTCTCTCTACAATTATCACACTCACACTCTA
 
. : . : . : . : . : . :
JMFS090G09+ AAGAGCCATTGTTTGTCTTGGAGATAA
JMFS136E06+ AAGAGCCATTGTTTGTCTTGGAGATAAGTTTTACAGTAAATAATATCTTAGCTTTGAGCG
                      ____________________________________________________________
consensus AAGAGCCATTGTTTGTCTTGGAGATAAGTTTTACAGTAAATAATATCTTAGCTTTGAGCG
 
. : . : . : . : . : . :
JMFS136E06+ AGGAAAACAAAAGTCAGCAAGAAATTAAAAGAAAAGGCAGCAGCATGGTGGAAAACGGGA
                      ____________________________________________________________
consensus AGGAAAACAAAAGTCAGCAAGAAATTAAAAGAAAAGGCAGCAGCATGGTGGAAAACGGGA
 
. : . : . : . : . : . :
JMFS136E06+ AAGTGAAAAAGATGAAAGAAACAGCGGGAAATAATACCGTTCTTTTGGCATGATCATTAA
                      ____________________________________________________________
consensus AAGTGAAAAAGATGAAAGAAACAGCGGGAAATAATACCGTTCTTTTGGCATGATCATTAA
 
. : . : . : . : . : . :
JMFS136E06+ GAAAGAGTTATTGACCACCCGCCATAAAAGCAAGGGAGTCTGGCCTTTATTGTGAATCAA
                      ____________________________________________________________
consensus GAAAGAGTTATTGACCACCCGCCATAAAAGCAAGGGAGTCTGGCCTTTATTGTGAATCAA