Previous Contig 004001:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS111B12Sequence620004001 (3)gb:AY363617_16027551e-27Malus baccata TIR-NBS-LRR type R protein 7 (R7) mRNA, complete cds.
JMFS135H01Sequence615004001 (3)gb:LCU516077_16840853e-42Lens culinaris partial rga gene for putative resistance gene analogue protein, c
JMSF026O09Sequence682004001 (3)gb:AY363617_16027552e-31Malus baccata TIR-NBS-LRR type R protein 7 (R7) mRNA, complete cds.692023251gb:AF198169_17764113e-11Aerides japonica 3-hydroxy-3-methylglutaryl-CoA-synthase (AHMCoA) mRNA, partial

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS111B12+ CCTTTAACAAACTTGAGCAACAGTGAAATGATAACTTACGGAGATTATGACAG
JMSF026O09+ CAGTGAAATGATAACTTACGGAGATTATGACAG
                      ____________________________________________________________
consensus CCTTTAACAAACTTGAGCAACAGTGAAATGATAACTTACGGAGATTATGACAG
 
. : . : . : . : . : . :
JMFS111B12+ CCACTAAAGTTCGGAGTCCTTGTGAGATGTTTGCACCAAGACAAATCCAAAGACTCGAGA
JMSF026O09+ CCACTAAAGTTCGGAGTCCTTGTGAGATGTTTGCACCAAGACAAATCCAAAGACTCGAGA
                      ____________________________________________________________
consensus CCACTAAAGTTCGGAGTCCTTGTGAGATGTTTGCACCAAGACAAATCCAAAGACTCGAGA
 
. : . : . : . : . : . :
JMFS111B12+ CAAGGAAAATACTTTAGAGGGGCTTTAAATTCTTTGATGTTGCTATTCCCAATTTCCAGA
JMSF026O09+ CAAGGAAAATACTTTAGAGGGGCTTTAAATTCTTTGATGTTGCTATTCCCAATTTCCAGA
                      ____________________________________________________________
consensus CAAGGAAAATACTTTAGAGGGGCTTTAAATTCTTTGATGTTGCTATTCCCAATTTCCAGA
 
. : . : . : . : . : . :
JMFS111B12+ CTCACAAGCTTCTCAAAAAAACCATTTGATGGAAAATTGATAGATTTCAAAGGGCAATGA
JMSF026O09+ CTCACAAGCTTCTCAAAAAAACCATTTGATGGAAAATTGATAGATTTCAAAGGGCAATGA
                      ____________________________________________________________
consensus CTCACAAGCTTCTCAAAAAAACCATTTGATGGAAAATTGATAGATTTCAAAGGGCAATGA
 
. : . : . : . : . : . :
JMFS111B12+ TTCCATTGCAAACATCTAAGCACCTTGGAACTGGATAGATGTTTGAATTTTCCATCAAGA
JMSF026O09+ TTCCATTGCAAACATCTAAGCACCTTGGAACTGGATAGATGTTTGAATTTTCCATCAAGA
                      ____________________________________________________________
consensus TTCCATTGCAAACATCTAAGCACCTTGGAACTGGATAGATGTTTGAATTTTCCATCAAGA
 
. : . : . : . : . : . :
JMFS111B12+ TGGACTTCATCAATTTCAAGAATTCTTAAATTCTCCATGTTCTTAAATGCTTTTGTATTG
JMSF026O09+ TGGACTTCATCAATTTCAAGAATTCTTAAATTCTCCATGTTCTTAAATGCTTTTGTATTG
                      ____________________________________________________________
consensus TGGACTTCATCAATTTCAAGAATTCTTAAATTCTCCATGTTCTTAAATGCTTTTGTATTG
 
. : . : . : . : . : . :
JMFS111B12+ TACTTCACATTTTTCATAGGAGAATAGTTGAATACAATCACCTCAATCTTTTTTGTACCC
JMSF026O09+ TACTTCACATTTTTCATAGGAGAATAGTTGAATACAATCACCTCAATCTTTTTTGTACCC
                      ____________________________________________________________
consensus TACTTCACATTTTTCATAGGAGAATAGTTGAATACAATCACCTCAATCTTTTTTGTACCC
 
. : . : . : . : . : . :
JMFS111B12+ TTTTCCCCTATAAGCACATCATGGATATCATAAGGACACCACAATCGACTACGCTCACCA
JMSF026O09+ TTTTCCCCTATAAGCACATCATGGATATCATAAGGACACCACAATCGACTACGCTCACCA
                      ____________________________________________________________
consensus TTTTCCCCTATAAGCACATCATGGATATCATAAGGACACCACAATCGACTACGCTCACCA
 
. : . : . : . : . : . :
JMFS111B12+ GGATTGTTGGGTGACTCCGAACGAATAATTTCTCTCCCCATCTCTCGAATTAAGCTATGC
JMSF026O09+ GGATTGTTGGGTGACTCCGAACGAATAATTTCTCTCCCCATCTCTCGAATTAAGCTATGC
JMFS135H01+ CGAATTAAGCTATGC
                      ____________________________________________________________
consensus GGATTGTTGGGTGACTCCGAACGAATAATTTCTCTCCCCATCTCTCGAATTAAGCTATGC
 
. : . : . : . : . : . :
JMFS111B12+ ATACTAATCTCAGACCACTCATCAAAATTTAGCAAGCATTTGTCAACCAAGTCTTGAATT
JMSF026O09+ ATACTAATCTCAGACCACTCATCAAAATTTAGCAAGCATTTGTCAACCAAGTCTTGAATT
JMFS135H01+ ATACTAATCTCAGACCACTCATCAAAATTTAGCAAGCATTTGTCAACCAAGTCTTGAATT
                      ____________________________________________________________
consensus ATACTAATCTCAGACCACTCATCAAAATTTAGCAAGCATTTGTCAACCAAGTCTTGAATT
 
. : . : . : . : . : . :
JMFS111B12+ TCAATGTCTGAGAAATACCCCATGTTA
JMSF026O09+ TCAATGTCTGAGAAATACCCCATGTTATCAATTTTCTCCTTAGAAACTCCACCGGAGAAA
JMFS135H01+ TCAATGTCTGAGAAATACCCCATGTTATCAATTTTCTCCTTAGAAACTCCACCGGAGAAA
                      ____________________________________________________________
consensus TCAATGTCTGAGAAATACCCCATGTTATCAATTTTCTCCTTAGAAACTCCACCGGAGAAA
 
. : . : . : . : . : . :
JMSF026O09+ CAAACAAGATCAAGAAAAAGAGATTTTATATGATCATCTGGAAGCCCA
JMFS135H01+ CAAACAAGATCAAGAAAAAGAGATTTTATATGATCATCTGGAAGCCCATCATAACTAATC
                      ____________________________________________________________
consensus CAAACAAGATCAAGAAAAAGAGATTTTATATGATCATCTGGAAGCCCATCATAACTAATC
 
. : . : . : . : . : . :
JMFS135H01+ TTAAGTTTAGCTTGAATGTCATTATGAGGAATTCCTTTCAATTTTTCAAATGCACTAACC
                      ____________________________________________________________
consensus TTAAGTTTAGCTTGAATGTCATTATGAGGAATTCCTTTCAATTTTTCAAATGCACTAACC
 
. : . : . : . : . : . :
JMFS135H01+ CACTCCTTTTTCGATTTATGACACAGATAAGCCCCTAAAACTTCAAGAGCTAATGGAAGT
                      ____________________________________________________________
consensus CACTCCTTTTTCGATTTATGACACAGATAAGCCCCTAAAACTTCAAGAGCTAATGGAAGT
 
. : . : . : . : . : . :
JMFS135H01+ CCCTCACAATAAGCAACTATGTCATCTAGAAGCTTATTATAATCTTCATTTTGCAACGCA
                      ____________________________________________________________
consensus CCCTCACAATAAGCAACTATGTCATCTAGAAGCTTATTATAATCTTCATTTTGCAACGCA
 
. : . : . : . : . : . :
JMFS135H01+ GGCTCTCCAAATGCATGTAGACTAAACAGCTGCAAAGACTCCTCATGGTTCAATACCTTA
                      ____________________________________________________________
consensus GGCTCTCCAAATGCATGTAGACTAAACAGCTGCAAAGACTCCTCATGGTTCAATACCTTA
 
. : . : . : . : . : . :
JMFS135H01+ ACTTCATAATGTTCGTCCACATTCAACTCTTTAAAAACATGTGCCTCTCTTGTGGTTAAA
                      ____________________________________________________________
consensus ACTTCATAATGTTCGTCCACATTCAACTCTTTAAAAACATGTGCCTCTCTTGTGGTTAAA
 
. : . : . : . : . : . :
JMFS135H01+ ATAAGTCTACTTCCTCCACCAAACCAATCTCGTCCTCCACATAATTTATTAAATTGATTT
                      ____________________________________________________________
consensus ATAAGTCTACTTCCTCCACCAAACCAATCTCGTCCTCCACATAATTTATTAAATTGATTT
 
. : . : . : . : . : . :
JMFS135H01+ CTATGCTCCAAATTATCAAGGACAATAAGACACTTTCTTGCTTGAAGTCGCCTTTTCATC
                      ____________________________________________________________
consensus CTATGCTCCAAATTATCAAGGACAATAAGACACTTTCTTGCTTGAAGTCGCCTTTTCATC