Previous Contig 004000:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS129G01Sequence626004000 (2)pir|H96658|H966589e-24hypothetical protein F9N12.8 [imported] - Arabidopsis thaliana>gb:AE005173_89399
JMFS135G03Sequence527004000 (2)gb:AB010072_15109304e-25Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MEE6.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS129G01- TTACGAATCGAGATTGCACGAGCTCACCTGTCAAGTCGAGAAATCTTT
                      ____________________________________________________________
consensus TTACGAATCGAGATTGCACGAGCTCACCTGTCAAGTCGAGAAATCTTT
 
. : . : . : . : . : . :
JMFS129G01- AAATGAATTGAACAGCATAACACATCTTAAGGACGAGAAGGACATGCTAGTTGGTAAACT
                      ____________________________________________________________
consensus AAATGAATTGAACAGCATAACACATCTTAAGGACGAGAAGGACATGCTAGTTGGTAAACT
 
. : . : . : . : . : . :
JMFS129G01- CGAGTCGGAGATAGGTACTCTTAGAGAGCAATATAACACTCGTTTTTCTGAGGATGAATC
                      ____________________________________________________________
consensus CGAGTCGGAGATAGGTACTCTTAGAGAGCAATATAACACTCGTTTTTCTGAGGATGAATC
 
. : . : . : . : . : . :
JMFS129G01- GGAGAAAGATAAGTTGAGGAAGCAGGTGTCCCAATTGAAGGGCAATCTGAAGAAGAAAGA
                      ____________________________________________________________
consensus GGAGAAAGATAAGTTGAGGAAGCAGGTGTCCCAATTGAAGGGCAATCTGAAGAAGAAAGA
 
. : . : . : . : . : . :
JMFS129G01- AGACGCATTAAATAGCTTAGATAAGAAACTCAAAGATGCAAACAACAAGCTCGCGTCTAC
                      ____________________________________________________________
consensus AGACGCATTAAATAGCTTAGATAAGAAACTCAAAGATGCAAACAACAAGCTCGCGTCTAC
 
. : . : . : . : . : . :
JMFS129G01- TAATGGAGCAAGAGCTGCTTCGAGGAACAATAAATTTGCATCTGCTACCCAGGGTCTCAA
                      ____________________________________________________________
consensus TAATGGAGCAAGAGCTGCTTCGAGGAACAATAAATTTGCATCTGCTACCCAGGGTCTCAA
 
. : . : . : . : . : . :
JMFS129G01- GGAGGTTAATAGTCTAAAGGATAAAATCAAATTGCTCGAGGGTCAGATCAAGCTTAAGGA
                      ____________________________________________________________
consensus GGAGGTTAATAGTCTAAAGGATAAAATCAAATTGCTCGAGGGTCAGATCAAGCTTAAGGA
 
. : . : . : . : . : . :
JMFS129G01- AAATGCTCTCGAGACCTCAACAAATTCGTTTTTGGAGAAGGAGCAAGACCTTCAAAATAA
JMFS135G03+ ACCTCAACAAATTCGTTTTTGGAGAAGGAGCAAGACCTTCAAAATAA
                      ____________________________________________________________
consensus AAATGCTCTCGAGACCTCAACAAATTCGTTTTTGGAGAAGGAGCAAGACCTTCAAAATAA
 
. : . : . : . : . : . :
JMFS129G01- AATTGAAGAGTATGAAGCGAGACTAGAACAAATCAATCAGAATACTGCAAGCATTTGTGA
JMFS135G03+ AATTGAAGAGTATGAAGCGAGACTAGAACAAATCAATCAGAATACTGCAAGCATTTGTGA
                      ____________________________________________________________
consensus AATTGAAGAGTATGAAGCGAGACTAGAACAAATCAATCAGAATACTGCAAGCATTTGTGA
 
. : . : . : . : . : . :
JMFS129G01- ACAGAATCCCGAAAAGGTAGCTACAGAAGACTTAAGTCTGAATTCTGGCATGACTGAAAC
JMFS135G03+ ACAGAATCCCGAAAAGGTAGCTACAGAAGACTTAAGTCTGAATTCTGGCATGACTGAAAC
                      ____________________________________________________________
consensus ACAGAATCCCGAAAAGGTAGCTACAGAAGACTTAAGTCTGAATTCTGGCATGACTGAAAC
 
. : . : . : . : . : . :
JMFS129G01- AGTAAATAGTGAGAATGGTTTACTATTGAGCGAAGTTA
JMFS135G03+ AGTAAATAGTGAGAATGGTTTACTATTGAGCGAAGTTACTTTACTGAGGGAGAAGAACTC
                      ____________________________________________________________
consensus AGTAAATAGTGAGAATGGTTTACTATTGAGCGAAGTTACTTTACTGAGGGAGAAGAACTC
 
. : . : . : . : . : . :
JMFS135G03+ ATTGATGGAAGACGAGTTGAAGGAAATGCAAGAGAGATACTCGGAAATAAGCCTCAAGTT
                      ____________________________________________________________
consensus ATTGATGGAAGACGAGTTGAAGGAAATGCAAGAGAGATACTCGGAAATAAGCCTCAAGTT
 
. : . : . : . : . : . :
JMFS135G03+ TGCAGAGGTAGAAGGCGAAAGACAGCAACTTGTGATGAAAGTGCGCAACCTTAAGAACGC
                      ____________________________________________________________
consensus TGCAGAGGTAGAAGGCGAAAGACAGCAACTTGTGATGAAAGTGCGCAACCTTAAGAACGC
 
. : . : . : . : . : . :
JMFS135G03+ AAAAAAGGGTCACTGAATCATCAACCAGATTCTTTTGCTGCTGAAAGATCTAGATGCAAT
                      ____________________________________________________________
consensus AAAAAAGGGTCACTGAATCATCAACCAGATTCTTTTGCTGCTGAAAGATCTAGATGCAAT
 
. : . : . : . : . : . :
JMFS135G03+ TTGTATTCAAGAATTCATTCAAGAATGAAAAAGAAAAAAAAAAAAATAGAGAAGGTTGTA
                      ____________________________________________________________
consensus TTGTATTCAAGAATTCATTCAAGAATGAAAAAGAAAAAAAAAAAAATAGAGAAGGTTGTA
 
. : . : . : . : . : . :
JMFS135G03+ TATTTATGAAATACATTCGTTCTTTGTTCAAAAAAAAAAAAAAAAAAACTCGAGACTAGT
                      ____________________________________________________________
consensus TATTTATGAAATACATTCGTTCTTTGTTCAAAAAAAAAAAAAAAAAAACTCGAGACTAGT