Previous Contig 003998:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS012A04Sequence272003998 (3)pir|D85360|D853607e-20hypothetical protein AT4g30790 [imported] - Arabidopsis thaliana>gb:ATCHRIV73_15
JMFS017H06Sequence627003998 (3)pir|D85360|D853601e-21hypothetical protein AT4g30790 [imported] - Arabidopsis thaliana>gb:ATCHRIV73_15
JMFS135F01Sequence652003998 (3)pir|D85360|D853605e-22hypothetical protein AT4g30790 [imported] - Arabidopsis thaliana>gb:ATCHRIV73_15

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS017H06+ GCA
                      ____________________________________________________________
consensus GCA
 
. : . : . : . : . : . :
JMFS012A04+ TCAGGAATGTCGATTTTCTCGACTTGCTCGGGGGCTGGAGGTGGTGCATTGC
JMFS017H06+ ACGGGGGATCAGGAATGTCGATTTTCTCGACTTGCTCGGGGGCTGNAGGTGGTGCATTGC
JMFS135F01+ TCAGGAATGTCGATTTTCTCGACTTGCTCGGGGGCTGGAGGTGGTGCATTGC
                      ____________________________________________________________
consensus ACGGGGGATCAGGAATGTCGATTTTCTCGACTTGCTCGGGGGCTGGAGGTGGTGCATTGC
 
. : . : . : . : . : . :
JMFS012A04+ TCCGCATTCTTGATTTGTTGAACAAGAACACTTCTTGATCGTCCGATGGGAGCTTGTAAG
JMFS017H06+ TCCGCATTCTTGATTTGTTGAACAAGAACACTTCTTGATCGTCCGATGGGAGCTTGTAAG
JMFS135F01+ TCCGCATTCTTGATTTGTTGAACAAGAACACTTCTTGATCGTCCGATGGGAGCTTGTAAG
                      ____________________________________________________________
consensus TCCGCATTCTTGATTTGTTGAACAAGAACACTTCTTGATCGTCCGATGGGAGCTTGTAAG
 
. : . : . : . : . : . :
JMFS012A04+ TCGAGAGGGGGCACCGAGGCTCCAGTTTCACATCCTGGCACAAGAGAAGATGATCATTCG
JMFS017H06+ TCGAGAGGGGGCACCGAGGCTCCAGTTTCACATCCTGGCACAAGAGAAGATGATCATTCG
JMFS135F01+ TCGAGAGGGGGCACCGAGGCTCCAGTTTCACATCCTGGCACAAGAGAAGATGATCATTCG
                      ____________________________________________________________
consensus TCGAGAGGGGGCACCGAGGCTCCAGTTTCACATCCTGGCACAAGAGAAGATGATCATTCG
 
. : . : . : . : . : . :
JMFS012A04+ AGGGAATCCCGCTCACCGATTCCAGGTATTCCTGCACGTTTTCAACGAGCGTATATCCAT
JMFS017H06+ AGGGAATCCCGCTCACCGATTCCAGGTATTCCTGCACGTTTTCAACGAGCGTATATCCAT
JMFS135F01+ AGGGAATCCCGCTCACCGATTCCAGGTATTCCTGCACGTTTTCAACGAGCGTATATCCAT
                      ____________________________________________________________
consensus AGGGAATCCCGCTCACCGATTCCAGGTATTCCTGCACGTTTTCAACGAGCGTATATCCAT
 
. : . : . : . : . : . :
JMFS012A04+ TGCAACTGAGCTCAAACGATTGCCCGTTCTCGGC
JMFS017H06+ TGCAACTGAGCTCAAACGATTGCCCGTTCTCGGCAATGTGAACTAAGAGCTTCCCATTTT
JMFS135F01+ TGCAACTGAGCTCAAACGATTGCCCGTTCTCGGCAATGTGAACTAAGAGCTTCCCATTTT
                      ____________________________________________________________
consensus TGCAACTGAGCTCAAACGATTGCCCGTTCTCGGCAATGTGAACTAAGAGCTTCCCATTTT
 
. : . : . : . : . : . :
JMFS017H06+ GAACTGCACCAGACAACACATTTGAACTCATCTTCTCCCCCAATTCCACAACTCCTCACC
JMFS135F01+ GAACTGCACCAGACAACACATTTGAACTCATCTTCTCCCCCAATTCCACAACTCCTCACC
                      ____________________________________________________________
consensus GAACTGCACCAGACAACACATTTGAACTCATCTTCTCCCCCAATTCCACAACTCCTCACC
 
. : . : . : . : . : . :
JMFS017H06+ AAATAAACAATTATCAAACCACCTTAAACTCTTGCCACGCCGCAATCTCCAGCCTTGTGA
JMFS135F01+ AAATAAACAATTATCAAACCACCTTAAACTCTTGCCACGCCGCAATCTCCAGCCTTGTGA
                      ____________________________________________________________
consensus AAATAAACAATTATCAAACCACCTTAAACTCTTGCCACGCCGCAATCTCCAGCCTTGTGA
 
. : . : . : . : . : . :
JMFS017H06+ TTAGGTCAATATTCTCTATGTATCTGATGATGGGTCTGCGTTTTCTTGTTTTCTGGAGCT
JMFS135F01+ TTAGGTCAATATTCTCTATGTATCTGATGATGGGTCTGCGTTTTCTTGTTTTCTGGAGCT
                      ____________________________________________________________
consensus TTAGGTCAATATTCTCTATGTATCTGATGATGGGTCTGCGTTTTCTTGTTTTCTGGAGCT
 
. : . : . : . : . : . :
JMFS017H06+ GAATAATACTCTTTTGTTCCCTTCCTTTTCCTCTCCTTTCTTCCCCTTCTTCTCGCTATT
JMFS135F01+ GAATAATACTCTTTTGTTCCCTTCCTTTTCCTCTCCTTTCTTCCCCTTCTTCTCGCTATT
                      ____________________________________________________________
consensus GAATAATACTCTTTTGTTCCCTTCCTTTTCCTCTCCTTTCTTCCCCTTCTTCTCGCTATT
 
. : . : . : . : . : . :
JMFS017H06+ TATCAGAGAAAAGGGTCCTTGTGAAAGAAGCAACCAACAGGGGTCAAGGAAGGATTTTCG
JMFS135F01+ TATCAGAGAAAAGGGTCCTTGTGAAAGAAGCAACCAACAGGGGTCAAGGAAGGATTTTCG
                      ____________________________________________________________
consensus TATCAGAGAAAAGGGTCCTTGTGAAAGAAGCAACCAACAGGGGTCAAGGAAGGATTTTCG
 
. : . : . : . : . : . :
JMFS017H06+ CAGTGGTCTTTTTCCCAGTTCCTC
JMFS135F01+ CAGTGGTCTTTTTCCCAGTTCCTCCACAATTTCATAAAAGAGAAAGAGCCTCGTGCCGAA
                      ____________________________________________________________
consensus CAGTGGTCTTTTTCCCAGTTCCTCCACAATTTCATAAAAGAGAAAGAGCCTCGTGCCGAA