Previous Contig 003997:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034P13Sequence512003997 (18)gb:AY065177_15663311e-54Arabidopsis thaliana putative heat-shock protein (At1g79920; F19K16.12) mRNA, co476003595 (4)gb:AY065177_15663313e-13Arabidopsis thaliana putative heat-shock protein (At1g79920; F19K16.12) mRNA, co
JMFS001C03Sequence623003997 (18)gb:AY065177_15663314e-78Arabidopsis thaliana putative heat-shock protein (At1g79920; F19K16.12) mRNA, co
JMFS032C01Sequence584003997 (18)gb:AY065177_15663311e-71Arabidopsis thaliana putative heat-shock protein (At1g79920; F19K16.12) mRNA, co
JMFS034E06Sequence616003997 (18)gb:AY065177_1566331e-101Arabidopsis thaliana putative heat-shock protein (At1g79920; F19K16.12) mRNA, co
JMFS049C07Sequence622003997 (18)pir|E96830|E968307e-82hypothetical protein F18B13.1 [imported] - Arabidopsis thaliana>gb:AE005173_8955
JMFS057F09Sequence627003997 (18)gb:AY065177_15663314e-78Arabidopsis thaliana putative heat-shock protein (At1g79920; F19K16.12) mRNA, co
JMFS070F01Sequence617003997 (18)pir|E96830|E968303e-81hypothetical protein F18B13.1 [imported] - Arabidopsis thaliana>gb:AE005173_8955
JMFS072A11Sequence542003997 (18)gb:AY065177_15663317e-60Arabidopsis thaliana putative heat-shock protein (At1g79920; F19K16.12) mRNA, co
JMFS124D02Sequence573003997 (18)gb:AY065177_15663315e-69Arabidopsis thaliana putative heat-shock protein (At1g79920; F19K16.12) mRNA, co
JMFS124H07Sequence574003997 (18)gb:AY065177_15663313e-72Arabidopsis thaliana putative heat-shock protein (At1g79920; F19K16.12) mRNA, co
JMFS130C04Sequence622003997 (18)gb:AY065177_15663311e-77Arabidopsis thaliana putative heat-shock protein (At1g79920; F19K16.12) mRNA, co
JMFS134C12Sequence589003997 (18)gb:AY065177_15663312e-68Arabidopsis thaliana putative heat-shock protein (At1g79920; F19K16.12) mRNA, co
JMFS135B04Sequence626003997 (18)gb:AY065177_15663313e-62Arabidopsis thaliana putative heat-shock protein (At1g79920; F19K16.12) mRNA, co
JMFS144C09Sequence626003997 (18)gb:AY065177_15663314e-78Arabidopsis thaliana putative heat-shock protein (At1g79920; F19K16.12) mRNA, co
JMFS165A01Sequence618003997 (18)gb:AY065177_15663311e-71Arabidopsis thaliana putative heat-shock protein (At1g79920; F19K16.12) mRNA, co
JMFS166E04Sequence627003997 (18)gb:AY065177_15663311e-77Arabidopsis thaliana putative heat-shock protein (At1g79920; F19K16.12) mRNA, co
JMSF021K01Sequence727003997 (18)pir|E96830|E968306e-92hypothetical protein F18B13.1 [imported] - Arabidopsis thaliana>gb:AE005173_8955732003595 (4)gb:AY065177_15663311e-30Arabidopsis thaliana putative heat-shock protein (At1g79920; F19K16.12) mRNA, co
JMSF040O05Sequence621003997 (18)gb:AY065177_15663313e-72Arabidopsis thaliana putative heat-shock protein (At1g79920; F19K16.12) mRNA, co143003595 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS034E06+ CAATACAAA
                      ____________________________________________________________
consensus CAATACAAA
 
. : . : . : . : . : . :
JMFS034E06+ CTTGCAAGCTAGCATGCCCAACATCAACAAAAGCAACATTTAGGGGCTCATTTTCAGGTA
                      ____________________________________________________________
consensus CTTGCAAGCTAGCATGCCCAACATCAACAAAAGCAACATTTAGGGGCTCATTTTCAGGTA
 
. : . : . : . : . : . :
JMFS034E06+ AATCAGTCTTGTAGATACCATAAGCCAATGCTGTGGCTGTAGTTTCATGGAAGAGACGTA
JMFS049C07+ ACGTA
JMFS070F01+ ACGTA
JMSF021K01+ AATCAGTCTTGTAGATACCATAAGCCAATGCTGTGGCTGTAGTTTCATGGAAGAGACGTA
                      ____________________________________________________________
consensus AATCAGTCTTGTAGATACCATAAGCCAATGCTGTGGCTGTAGTTTCATGGAAGAGACGTA
 
. : . : . : . : . : . :
JMFS034E06+ GTGGGTGTAGACCAGCAATTGTAGCAGCATCTATAACTGCTCTTCTCTGGAGATCAGTAA
JMFS057F09+ AGCAATTGTAGCAGCATCTATAACTGCTCTTCTCTGGAGATCAGTAA
JMFS166E04+ CAATTGTAGCAGCATCTATAACTGCTCTTCTCTGGAGATCAGTAA
JMFS165A01+ GCAATTGTAGCAGCATCTATAACTGCTC-TCTCTGNAGATCAGTAA
JMFS032C01+ AGATCAGTAA
JMFS124H07+ GGAGATCAGTAA
JMFS001C03+ CAGCAATTGTAGCAGCATCTATAACTGCTCTTCTCTGGAGATCAGTAA
JMFS144C09+ CCAGCAATTGTAGCAGCATCTATAACTGCTCTTCTCTGGAGATCAGTAA
JMFS130C04+ CAATTGTAGCAGCATCTATAACTGCTCTTCTCTGGAGATCAGTAA
JMFS049C07+ GTGGGTGTAGACCAGCAATTGTAGCAGCATCTATAACTGCTCTTCTCTGGAGATCAGTAA
JMFS070F01+ GTGGGTGTAGACCAGCAATTGTAGCAGCATCTATAACTGCTCTTCTCTGGAGATCAGTAA
JMSF021K01+ GTGGGTGTAGACCAGCAATTGTAGCAGCATCTATAACTGCTCTTCTCTGGAGATCAGTAA
JMSF040O05+ TCTCTGGAGATCAGTAA
                      ____________________________________________________________
consensus GTGGGTGTAGACCAGCAATTGTAGCAGCATCTATAACTGCTCTTCTCTGGAGATCAGTAA
 
. : . : . : . : . : . :
JMFS034E06+ AATAGACGGGTATCCCAATGCAGCAATCCACTACTGCAGCATTCAGATTTGTCTCTGCAA
JMFS124D02+ GACGGGTATCCCAATGCAGCAATCCACTACTGCAGCATTCAGATTTGTCTCTGCAA
JMFS057F09+ AATAGACGGGTATCCCAATGCAGCAATCCACTACTGCAGCATTCAGATTTGTCTCTGCAA
JMFS166E04+ AATAGACGGGTATCCCAATGCAGCAATCCACTACTGCAGCATTCAGATTTGTCTCTGCAA
JMFS165A01+ AATAGACGGGTATCCCAATGCAGCAATCCACTACTGCAGCATTCAGATTTGTCTCTGCAA
JMFS032C01+ AATAGACGGGTATCCCAATGCAGCAATCCACTACTGCAGCATTCAGATTTGTCTCTGCAA
JMFS124H07+ AATAGACGGGTATCCCAATGCAGCAATCCACTACTGCAGCATTCAGATTTGTCTCTGCAA
JMFS001C03+ AATAGACGGGTATCCCAATGCAGCAATCCACTACTGCAGCATTCAGATTTGTCTCTGCAA
JMFS144C09+ AATAGACGGGTATCCCAATGCAGCAATCCACTACTGCAGCATTCAGATTTGTCTCTGCAA
JMFS130C04+ AATAGACGGGTATCCCAATGCAGCAATCCACTACTGCAGCATTCAGATTTGTCTCTGCAA
JMFS049C07+ AATAGACGGGTATCCCAATGCAGCAATCCACTACTGCAGCATTCAGATTTGTCTCTGCAA
JMFS070F01+ AATAGACGGGTATCCCAATGCAGCAATCCACTACTGCAGCATTCAGATTTGTCTCTGCAA
JMFS134C12+ ACGGGTATCCCAATGCAGCAATCCACTACTGCAGCATTCAGATTTGTCTCTGCAA
JMSF021K01+ AATAGACGGGTATCCCAATGCAGCAATCCACTACTGCAGCATTCAGATTTGTCTCTGCAA
JMFS072A11+ TGCAGCATTCAGA-TTGTCTCTGCAA
JMSF040O05+ AATAGACGGGTATCCCAATGCAGCAATCCANTACTGCAGCATTCAGATTTGTCTCTGCAA
JMFS135B04+ TGCAGCATTCAGATTTGTCTCTGCAA
                      ____________________________________________________________
consensus AATAGACGGGTATCCCAATGCAGCAATCCACTACTGCAGCATTCAGATTTGTCTCTGCAA
 
. : . : . : . : . : . :
JMFS034E06+ TGCTCTTCAGATTTGACAACACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
JMFS124D02+ TGCTCTTCAGATTTGACAACACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
JMFS057F09+ TGCTCTTCAGATTTGACAACACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
JMFS166E04+ TGCTCTTCAGATTTGACAACACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
JMFS165A01+ TGCTCTTCAGATTTGACAACACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
JMFS032C01+ TGCTCTTCAGATTTGACAACACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
JMFS124H07+ TGCTCTTCAGATTTGACAACACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
JMFS001C03+ TGCTCTTCAGATTTGACAACACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
JMFS144C09+ TGCTCTTCAGATTTGACAACACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
JMFS130C04+ TGCTCTTCAGATTTGACAACACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
JMFS049C07+ TGCTCTTCAGATTTGACAACACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
JMFS070F01+ TGCTCTTCAGATTTGACAACACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
JMFS134C12+ TGCTCTTCAGATTTGACAACACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
JMSF021K01+ TGCTCTTCAGATTTGACAACACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
JMFS072A11+ TGCTCTTCAGATTTGACACNACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
JMSF040O05+ TGCTCTTCAGATTTGACAACACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
JMFF034P13+ CCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
JMFS135B04+ TGCTCTTCAGATTTGACAACACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
                      ____________________________________________________________
consensus TGCTCTTCAGATTTGACAACACCATTCCCAGAACTTGGGTGGGTGTAAAAGTTCTCATTT
 
. : . : . : . : . : . :
JMFS034E06+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
JMFS124D02+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
JMFS057F09+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
JMFS166E04+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
JMFS165A01+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
JMFS032C01+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
JMFS124H07+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
JMFS001C03+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
JMFS144C09+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
JMFS130C04+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
JMFS049C07+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
JMFS070F01+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
JMFS134C12+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
JMSF021K01+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
JMFS072A11+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
JMSF040O05+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
JMFF034P13+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
JMFS135B04+ CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
                      ____________________________________________________________
consensus CCCCCAAATATCGAGCATGGATCAATGGAAATCCATCAGGGCCTTCAGTCACAGAGAAAG
 
. : . : . : . : . : . :
JMFS034E06+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
JMFS124D02+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
JMFS057F09+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
JMFS166E04+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
JMFS165A01+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
JMFS032C01+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
JMFS124H07+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
JMFS001C03+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
JMFS144C09+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
JMFS130C04+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
JMFS049C07+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
JMFS070F01+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
JMFS134C12+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
JMSF021K01+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
JMFS072A11+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
JMSF040O05+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
JMFF034P13+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
JMFS135B04+ GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
                      ____________________________________________________________
consensus GAAAAGACTTGAGATCCCTTTGCAACTCAGGATCTGAAAATTGACGTCCAATCAATCTCT
 
. : . : . : . : . : . :
JMFS034E06+ TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
JMFS124D02+ TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
JMFS057F09+ TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
JMFS166E04+ TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
JMFS165A01+ TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
JMFS032C01+ TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
JMFS124H07+ TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
JMFS001C03+ TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
JMFS144C09+ TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
JMFS130C04+ TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
JMFS049C07+ TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
JMFS070F01+ TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
JMFS134C12+ TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
JMSF021K01+ TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
JMFS072A11+ TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
JMSF040O05+ TTNCCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
JMFF034P13+ TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
JMFS135B04+ TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
                      ____________________________________________________________
consensus TTACCTGAGAAATTGTGTTCTTTGGATTCATCATACTAGTTGCAGCACCAGCTGTACCAA
 
. : . : . : . : . : . :
JMFS034E06+ GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
JMFS124D02+ GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
JMFS057F09+ GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
JMFS166E04+ GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
JMFS165A01+ GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
JMFS032C01+ GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
JMFS124H07+ GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
JMFS001C03+ GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
JMFS144C09+ GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
JMFS130C04+ GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
JMFS049C07+ GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
JMFS070F01+ GGAATGTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
JMFS134C12+ GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
JMSF021K01+ GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
JMFS072A11+ GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
JMSF040O05+ GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
JMFF034P13+ GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
JMFS135B04+ GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
                      ____________________________________________________________
consensus GGAATCTTTGCTTTTCACCAAAGCAAACAAGAGCTGGAGTTTCTCTCTTTGATTCATCAT
 
. : . : . : . : . : . :
JMFS034E06+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
JMFS124D02+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
JMFS057F09+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
JMFS166E04+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
JMFS165A01+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
JMFS032C01+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
JMFS124H07+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
JMFS001C03+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
JMFS144C09+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
JMFS130C04+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
JMFS049C07+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
JMFS070F01+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
JMFS134C12+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
JMSF021K01+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
JMFS072A11+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
JMSF040O05+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
JMFF034P13+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
JMFS135B04+ TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
                      ____________________________________________________________
consensus TAAGTACAACATCAATTCCCCTCTGTCTTGCAACTGCAACGACACAACTCTCGTTCCCAA
 
. : . : . : . : . : . :
JMFS034E06+ CATCAAA
JMFS124D02+ CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
JMFS057F09+ CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
JMFS166E04+ CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
JMFS165A01+ CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
JMFS032C01+ CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
JMFS124H07+ CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
JMFS001C03+ CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
JMFS144C09+ CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
JMFS130C04+ CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
JMFS049C07+ CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
JMFS070F01+ CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
JMFS134C12+ CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
JMSF021K01+ CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
JMFS072A11+ CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
JMSF040O05+ CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
JMFF034P13+ CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
JMFS135B04+ CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
                      ____________________________________________________________
consensus CATCAAACCCTACTACGCTCATTTTTGTTGCAAGAAGCAATTAAAGTCCAACAGAACGAA
 
. : . : . : . : . : . :
JMFS124D02+ AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
JMFS057F09+ AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
JMFS166E04+ AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
JMFS165A01+ AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
JMFS032C01+ AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
JMFS124H07+ AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
JMFS001C03+ AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
JMFS144C09+ AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
JMFS130C04+ AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
JMFS049C07+ AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
JMFS070F01+ AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
JMFS134C12+ AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
JMSF021K01+ AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
JMFS072A11+ AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
JMSF040O05+ AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
JMFF034P13+ AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
JMFS135B04+ AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
                      ____________________________________________________________
consensus AAACCGGAAGGAGGCAGAGCAGGAAGTGCCGGAAGGATCGAGCGAGCAAAAGCGCACAGG
 
. : . : . : . : . : . :
JMFS124D02+ TGTATTCTAGAACTCTCTCTTCCCTACTACGGCGGTA
JMFS057F09+ TGTATTCTAGAACTCTCTCTTCCCTACTACGGCGGTATGT
JMFS166E04+ TGTATTCTAGAACTCTCTCTTCCCTACTACGGCGGTATGTT
JMFS165A01+ TGTATTCTAGAACTCTCTCTTCCCTACTACGGC
JMFS032C01+ TGTATTCTAGAACTCTCTCTTCCCTACTACGGCG
JMFS124H07+ TGTATTCTAGAACTCTCTCTTC
JMFS001C03+ TGTATTCTAGAACTCTCTCTTCCCTACTACGGCGG
JMFS144C09+ TGTATTCTAGAACTCTCTCTTCCCTACTACGGCGGTA
JMFS130C04+ TGTATTCTAGAACTCTCTCTTCCCTACTACGGCGGTA
JMFS049C07+ TGTATTCTAGAACTCTC
JMFS070F01+ TGTATTCTAGA
JMFS134C12+ TGTATTCTAGAACTCTCTCTTCCCTACTACGGCGGTATGTTT
JMSF021K01+ TGTATTCTAGAACTCTCTCTTCCCTACTACGGCGGTATGTTTAGAGACAGGAAA
JMFS072A11+ TGTATTCTAGAACTCTCTCTTCCCTACTACGGCGGTA
JMSF040O05+ TGTATTCTAGAACTCTCTCTTCCCTACTACGGCGGTATGTTTAGAGACAGGAAA
JMFF034P13+ TGTATTCTAGAACTCTCTCTTCCCTACTACGGCGGTATGTTTAGAGACAGGAAA
JMFS135B04+ TGTATTCTAGAACTCTCTCTTCCCTACTACGGCGGTATGTTTAGAGACAGGAAAGTATGA
                      ____________________________________________________________
consensus TGTATTCTAGAACTCTCTCTTCCCTACTACGGCGGTATGTTTAGAGACAGGAAAGTATGA
 
. : . : . : . : . : . :
JMFS135B04+ CCGGATACGAAAGGGAAAAATAGGGGTTTTAAAGCCAGTAAGCGAAGGTGGGGTTTGTGT
                      ____________________________________________________________
consensus CCGGATACGAAAGGGAAAAATAGGGGTTTTAAAGCCAGTAAGCGAAGGTGGGGTTTGTGT