Previous Contig 003993:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN038A14Sequence614003993 (10)gb:AY085687_15707544e-29Arabidopsis thaliana clone 17101 mRNA, complete sequence.
JMFS134G02Sequence626003993 (10)gb:AY085687_15707544e-43Arabidopsis thaliana clone 17101 mRNA, complete sequence.
JMSF009F24Sequence379003993 (10)gb:AY045614_15612051e-20Arabidopsis thaliana At1g19950/T20H2_25 mRNA, complete cds.>gb:BT001012_1635267 670003993 (10)gb:AP003528_18304965e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P063
JMSF028J22Sequence637003993 (10)gb:AY085687_15707541e-59Arabidopsis thaliana clone 17101 mRNA, complete sequence.654003993 (10)gb:AP003528_18304965e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P063
JMSF029H13Sequence673003993 (10)gb:AY085687_15707544e-64Arabidopsis thaliana clone 17101 mRNA, complete sequence.738003993 (10)gb:AY085687_15707542e-19Arabidopsis thaliana clone 17101 mRNA, complete sequence.
JMSF052E15Sequence704003993 (10)gb:AY085687_15707541e-61Arabidopsis thaliana clone 17101 mRNA, complete sequence.897003993 (10)gb:AY085687_15707542e-41Arabidopsis thaliana clone 17101 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF028J22- ATTCCTA
rJMSF009F24- TAAGCAGCAGCAGAGGAATTCCTA
                      ____________________________________________________________
consensus TAAGCAGCAGCAGAGGAATTCCTA
 
. : . : . : . : . : . :
rJMSF028J22- TTTCCTAATTAACGTTTGATGTCATGAGCAAAGATTCATTAACAGGCCTCCATTTGGTCC
rJMSF009F24- TTTCCTAATTAACGTTTGATGTCATGAGCAAAGATTCATTAACAGGCCTCCATTTGGTCC
                      ____________________________________________________________
consensus TTTCCTAATTAACGTTTGATGTCATGAGCAAAGATTCATTAACAGGCCTCCATTTGGTCC
 
. : . : . : . : . : . :
rJMSF028J22- TACCCATTCATTTTTGTCAGCCCAT-GCTTAAAAACCACGGACAACTTGAGGTAATGAAT
rJMSF009F24- TACCCATTCATTTTTGTCAGCCCAT-GCTTAAAAACCACGGACAACTTGAGGTAATGAAT
rJMSF029H13- AAACCACGGACAACTTGAGGTAATGAAT
rJMSF052E15- ATTTTTGTCAGCCCATGGCTTAAAAACCACGGACAACTTGAGGTAATGAAT
                      ____________________________________________________________
consensus TACCCATTCATTTTTGTCAGCCCAT-GCTTAAAAACCACGGACAACTTGAGGTAATGAAT
 
. : . : . : . : . : . :
rJMSF028J22- GAAAGAAAGAAAGAAATGTGAAAATGTACAACATTGTGGACCTATAAAACCATCCTTTTT
rJMSF009F24- GAAAGAAAGAAAGAAATGTGAAAATGTACAACATTGTGGACCTATAAAACCATCCTTTTT
rJMSF029H13- GAAAGAAAGAAAGAAATGTGAAAATGTACAACATTGTGGACCTATAAAACCATCCTTTTT
rJMSF052E15- GAAAGAAAGAAAGAAATGTGAAAATGTACAACATTGTGGACCTATAAAACCATCCTTTTT
                      ____________________________________________________________
consensus GAAAGAAAGAAAGAAATGTGAAAATGTACAACATTGTGGACCTATAAAACCATCCTTTTT
 
. : . : . : . : . : . :
rJMSF028J22- CACCTACCACCTAAACACATTTCACAAAGTAACATGGTAAGGGACTAAGGGGCCTGACCG
rJMSF009F24- CACCTACCACCTAAACACATTTCACAAAGTAACATGGTAAGGGACTAAGGGGCCTGACCG
rJMSF029H13- CACCTACCACCTAAACACATTTCACAAAGTAACATGGTAAGGGACTAAGGGGCCTGACCG
rJMSF052E15- CACCTACCACCTAAACACATTTCACAAAGTAACATGGTAAGGGACTAAGGGGCCTGACCG
                      ____________________________________________________________
consensus CACCTACCACCTAAACACATTTCACAAAGTAACATGGTAAGGGACTAAGGGGCCTGACCG
 
. : . : . : . : . : . :
rJMSF028J22- CACGATAGTCACTGGTCTGAAGCAGCACGCTGGATTTTCCTTGACCTTGCTCTAGTAACT
rJMSF009F24- CACGATAGTCACTGGTCTGAAGCAGCACGCTGGATTTTCCTTGACCTTGCTCTAGTAACT
rJMSF029H13- CACGATAGTCACTGGTCTGAAGCAGCACGCTGGATTTTCCTTGACCTTGCTCTAGTAACT
JMFN038A14+ GCTGGATTTTCCTTGACCTTGCTCTAGTAACT
rJMSF052E15- CACGATAGTCACTGGTCTGAAGCAGCACGCTGGATTTTCCTTGACCTTGCTCTAGTAACT
                      ____________________________________________________________
consensus CACGATAGTCACTGGTCTGAAGCAGCACGCTGGATTTTCCTTGACCTTGCTCTAGTAACT
 
. : . : . : . : . : . :
rJMSF028J22- CGAGCAGCCCCTTCCACCATAACAGTATCTGTGGGGGGTTTGGTGCTTTCGTCCGCCAGA
rJMSF009F24- CGAGCAGCCCCTTCCACCATAACAGTATCTGTGGGGGGTTTGGTGCTTTCGTCCGCCAGA
rJMSF029H13- CGAGCAGCCCCTTCCACCATAACAGTATCTGTGGGGGGTTTGGTGCTTTCGTCCGCCAGA
JMFN038A14+ CGAGCAGCCCCTTCCACCATAACAGTATCTGTGGGGGGTTTGGTGCTTTCGTCCGCCAGA
rJMSF052E15- CGAGCAGCCCCTTCCACCATAACAGTATCTGTGGGGGGTTTGGTGCTTTCGTCCGCCAGA
                      ____________________________________________________________
consensus CGAGCAGCCCCTTCCACCATAACAGTATCTGTGGGGGGTTTGGTGCTTTCGTCCGCCAGA
 
. : . : . : . : . : . :
rJMSF028J22- GAATGCACGGGGGGTTCAATCTGCATTGCCTGTGCTTCGCTGGAACTTGGAGCTTTGATG
rJMSF009F24- GAATGCACGGGGGGTTCAATCTGCATTGCCTGTGCTTCGCTGGAACTTGGAGCTTTGATG
rJMSF029H13- GAATGCACGGGGGGTTCAATCTGCATTGCCTGTGCTTCGCTGGAACTTGGAGCTTTGATG
JMFN038A14+ GAATGCACGGGGGGTTCAATCTGCATTGCCTGTGCTTCGCTGGAACTTGGAGCTTTGATG
rJMSF052E15- GAATGCACGGGGGGTTCAATCTGCATTGCCTGTGCTTCGCTGGAACTTAGAGCTTTGATG
                      ____________________________________________________________
consensus GAATGCACGGGGGGTTCAATCTGCATTGCCTGTGCTTCGCTGGAACTTGGAGCTTTGATG
 
. : . : . : . : . : . :
rJMSF028J22- GTTTCAGCAAGGGGTTTTGTCGGTGTGGTTTTTTGAGCATTCAAGGAAGCAGTGGGCACA
rJMSF009F24- GTTTCAGCAAGGGGTTTTGTCGGTGTGGTTTTTTGAGCATTCAAGGAAGCAGTGGGCACA
rJMSF029H13- GTTTCAGCAAGGGGTTTTGTCGGTGTGGTTTTTTGAGCATTCAAGGAAGCAGTGGGCACA
JMFN038A14+ GTTTCAGCAAGGGGTTTTGTCGGTGTGGTTTTTTGAGCATTCAAGGAAGCAGTGGGCACA
rJMSF052E15- GTTTCAGCAAGGGGTTTTGTCGGTGTGGTTTTTTGAGCATTCAAGGAAGCAGTGGGCACA
                      ____________________________________________________________
consensus GTTTCAGCAAGGGGTTTTGTCGGTGTGGTTTTTTGAGCATTCAAGGAAGCAGTGGGCACA
 
. : . : . : . : . : . :
rJMSF028J22- GCTGTTTTAGGAGGTGCACCATCTTCAAGTTCGCTTGCAGGTTCACCGGGAGCAGCAGGA
rJMSF009F24- GCTGTTTTAGGAGGTGCACCATCTTCAAGTTCGCTTGCAGGTTCACCGGGAGCAGCAGGA
rJMSF029H13- GCTGTTTTAGGAGGTGCACCATCTTCAAGTTCGCTTGCAGGTTCACCGGGAGCAGCAGGA
JMFN038A14+ GCTGTTTTAGGAGGTGCACCATCTTCAAGTTCGCTTGCAGGTTCACCGGGAGCAGCAGGA
rJMSF052E15- GCTGTTTTAGGAGGTGCACCATCTTCAAGTTCGCTTGCAGGTTCACCGGGAGCAGCAGGA
                      ____________________________________________________________
consensus GCTGTTTTAGGAGGTGCACCATCTTCAAGTTCGCTTGCAGGTTCACCGGGAGCAGCAGGA
 
. : . : . : . : . : . :
rJMSF028J22- GGCCGATCTTCAGTTTGTGGCTCTATTGTTGCAGATTCTGCTCTCTGATTTGCTGGTGCA
rJMSF009F24- GGCCGATCTTCAGTTTGTGGCTCTATTGTTGCAGATTCTGCTCTCTGATTTGCTGGTGCA
rJMSF029H13- GGCCGATCTTCAGTTTGTGGCTCTATTGTTGCAGATTCTGCTCTCTGATTTGCTGGTGCA
JMFN038A14+ GGCCGATCTTCAGTTTGTGGCTCTATTGTTGCAGATTCTGCTCTCTGATTTGCTGGTGCA
rJMSF052E15- GGCCGATCTTCAGTTTGTGGCTCTATTGTTGCAGATTCTGCTCTCTGATTTGCTGGTGCA
                      ____________________________________________________________
consensus GGCCGATCTTCAGTTTGTGGCTCTATTGTTGCAGATTCTGCTCTCTGATTTGCTGGTGCA
 
. : . : . : . : . : . :
rJMSF028J22- GGAGGTCCGGGGACTCTAGTGCTGCCTTGCCTCCGTGGCTG
rJMSF009F24- GGAGGTCCGGGGACTCTAGTGCTGCCTTGCCTCCGTGGCTGTGCAGG
rJMSF029H13- GGAGGTCCGGGGACTCTAGTGCTGCCTTGCCTCCGTGGCTGTGCAGGGGGAGGTGGAGTT
JMFN038A14+ GGAGGTCCGGGGACTCTAGTGCTGCCTTGCCTCCGTGGCTGTGCAGGGGGAGGTGGAGTT
rJMSF052E15- GGAGGTCCGGGGACTCTAGTGCTGCCTTGCCTCCGTGGCTGTGCAGGGGGAGGTGGAGTT
JMSF052E15+ TAGTGCTGCCTTGCCTCCGTGGCTGTGCAGGGGGAGGTGGAGTT
JMSF029H13+ GGGGAGGTGGAGTT
                      ____________________________________________________________
consensus GGAGGTCCGGGGACTCTAGTGCTGCCTTGCCTCCGTGGCTGTGCAGGGGGAGGTGGAGTT
 
. : . : . : . : . : . :
rJMSF029H13- GACTGTGAAGCAATATACTGCAAGACATCAAAAATTCTTGTCTGACCATAACTAGCAGCC
JMFN038A14+ GACTGTGAAGCAATATACTGCAAGACATCAAAAATTCTTGTCTGACCATAACTAGCAGCC
rJMSF052E15- GACTGTGAAGCAATATACTGCAAGACATCAAAAATTCTTGTCTGACCATAACTAGCAGCC
JMSF052E15+ GACTGTGAAGCAATATACTGCAAGACATCAAAAATTCTTGTCTGACCATAACTAGCAGCC
JMSF029H13+ GACTGTGAAGCAATATACTGCAAGACATCAAAAATTCTTGTCTGACCATAACTAGCAGCC
JMSF028J22+ GACATCAAAAATTCTTGTCTGACCATAACTAGCAGCC
                      ____________________________________________________________
consensus GACTGTGAAGCAATATACTGCAAGACATCAAAAATTCTTGTCTGACCATAACTAGCAGCC
 
. : . : . : . : . : . :
rJMSF029H13- TTTTGCCAATACAAAAATACTGCATCTCCAGCCCAAGTCTTCAATTCCAGCAAATTGCGA
JMFN038A14+ TTTTGCCAATACAAAAATACTGCATCTCCAGCCCAAGTCTTCAATTCCAGCAAATTGCGA
rJMSF052E15- TTTTGCCAATACAAAAATACTGCATCTCCAGCCCAAGTCTTCAATTCCAGCAAATTGCGA
JMSF052E15+ TTTTGCCAATACAAAAATACTGCATCTCCAGCCCAAGTCTTCAATTCCAGCAAATTGCGA
JMSF029H13+ TTTTGCCAATACAAAAATACTGCATCTCCAGCCCAAGTCTTCAATTCCAGCAAATTGCGA
JMSF028J22+ TTTTGCCAATACAAAAATACTGCATCTCCAGCCCAAGTCTTCAATTCCAGCAAATTGCGA
                      ____________________________________________________________
consensus TTTTGCCAATACAAAAATACTGCATCTCCAGCCCAAGTCTTCAATTCCAGCAAATTGCGA
 
. : . : . : . : . : . :
rJMSF029H13- TCAATCTCTGGCTCATGTCTTAGAACCAGTGGCCTAAAGAATGCATCGTA
JMFN038A14+ TCAATCTCTGGCTCATGTCTTAGAACCAGTGGCCTAAAGAATGCATCGTAGACATAAGTT
rJMSF052E15- TCAATCTCTGGCTCATGTCTTAGAACCAGTGGCCTAAAGAATGCATCGTAGACATAAGTT
JMSF052E15+ TCAATCTCTGGCTCATGTCTTAGAACCAGTGGCCTAAAGAATGCATCGTAGACATAAGTT
JMSF029H13+ TCAATCTCTGGCTCATGTCTTAGAACCAGTGGCCTAAAGAATGCATCGTAGACCTAAGTT
JMSF028J22+ TCAATCTCTGGCTCATGTCTTAGAACCAGTGGCCTAAAGAATGCATCGTAGACATAAGTT
JMFS134G02+ TAAAGAATGCATCGTAGACATAAGTT
                      ____________________________________________________________
consensus TCAATCTCTGGCTCATGTCTTAGAACCAGTGGCCTAAAGAATGCATCGTAGACATAAGTT
 
. : . : . : . : . : . :
JMFN038A14+ GTTCCCTTAGTCTTTGGCAACCACAAGTATATGTAGAATGCC
rJMSF052E15- GTTCCCTTAGTCTTTGGGAACCACAAGTATATGTAGAATGCCAACTTAGCTTCACTATAC
JMSF052E15+ GTTCCCTTAGTCTTTGGGAACCACAAGTATATGTAGAATGCCAACTTAGCTTCACTATAC
JMSF029H13+ GTTCCCTTAGTCTTTGGGAACCACAAGTATATGTAGAATGCCAACTTAGCTTCACTATAC
JMSF028J22+ GTTCCCTTAGTCTTTGGGAACCACAAGTATATGTAGAATGCCAACTTAGCTTCACTATAC
JMFS134G02+ GTTCCCTTAGTCTTTGGGAACCACAAGTATATGTAGAATGCCAACTTAGCTTCACTATAC
                      ____________________________________________________________
consensus GTTCCCTTAGTCTTTGGGAACCACAAGTATATGTAGAATGCCAACTTAGCTTCACTATAC
 
. : . : . : . : . : . :
rJMSF052E15- ATAGGAACCCATGAGACAAAAGTATCAGCAATTCTCTCACAAACGGTCATTATAGCAACT
JMSF052E15+ ATAGGAACCCATGAGACAAAAGTATCAGCAATTCTCTCACAAACGGTCATTATAGCAACT
JMSF029H13+ ATAGGAACCCATGAGACAAAAGTATCAGCAATTCTCTCACAAACGGTCATTATAGCAACT
JMSF028J22+ ATAGGAACCCATGAGACAAAAGTATCAGCAATTCTCTCACAAACGGTCATTATAGCAACT
JMSF009F24+ ACGGTCATTATAGCAACT
JMFS134G02+ ATAGGAACCCATGAGACAAAAGTATCAGCAATTCTCTCACAAACGGTCATTATAGCAACT
                      ____________________________________________________________
consensus ATAGGAACCCATGAGACAAAAGTATCAGCAATTCTCTCACAAACGGTCATTATAGCAACT
 
. : . : . : . : . : . :
rJMSF052E15- ATGATC
JMSF052E15+ ATGATCCAATACTGGCACCAAAAGCGAAGTTGCTGGATATCTGGCTTATTCAACTCCACA
JMSF029H13+ ATGATCCAATACTGGCACCAAAAGCGAAGTTGCTGGATATCTGGCTTATTCAACTCCACA
JMSF028J22+ ATGATCCAATACTGGCACCAAAAGCGAAGTTGCTGGATATCTGGCTTATTCAACTCCACA
JMSF009F24+ ATGATCCAATACTGGCACCAAAAGCGAAGTTGCTGGATATCTGGCTTATTCAACTCCACA
JMFS134G02+ ATGATCCAATACTGGCACCAAAAGCGAAGTTGCTGGATATCTGGCTTATTCAACTCCACA
                      ____________________________________________________________
consensus ATGATCCAATACTGGCACCAAAAGCGAAGTTGCTGGATATCTGGCTTATTCAACTCCACA
 
. : . : . : . : . : . :
JMSF052E15+ GTTTTAAAGCACTCATAAGCTGGATATGCATAACCAAAAACCATCACAAGGCCTCTGGTG
JMSF029H13+ GTTTTAAAGCACTCATAAGCTGGATATGCATAACCAAAAACCATCACAAGGCCTCTGGTG
JMSF028J22+ GTTTTAAAGCACTCATAAGCTGGATATGCATAACCAAAAACCATCACAAGGCCTCTGGTG
JMSF009F24+ GTTTTAAAGCACTCATAAGCTGGATATGCATAACCAAAAACCATCACAAGGCCTCTGGTG
JMFS134G02+ GTTTTAAAGCACTCATAAGCTGGATATGCATAACCAAAAACCATCACAAGGCCTCTGGTG
                      ____________________________________________________________
consensus GTTTTAAAGCACTCATAAGCTGGATATGCATAACCAAAAACCATCACAAGGCCTCTGGTG
 
. : . : . : . : . : . :
JMSF052E15+ AGAAACGAGCCAATCATGTTGATTTCAATTGCAAAATATCGAAAGTGATCGGTAGTTGAG
JMSF029H13+ AGAAACGAGCCAATCATGTTGATTTCAATTGCAAAATATCGAAAGTGATCGGTAGTTGAG
JMSF028J22+ AGAAACGAGCCAATCATGTTGATTTCAATTGCAAAATATCGAAAGTGATCGGTAGTTGAG
JMSF009F24+ AGAAACGAGCCAATCATGTTGATTTCAATTGCAAAATATCGAAAGTGATCGGTAGTTGAG
JMFS134G02+ AGAAACGAGCCAATCATGTTGATTTCAATTGCAAAATATCGAAAGTGATCGGTAGTTGAG
                      ____________________________________________________________
consensus AGAAACGAGCCAATCATGTTGATTTCAATTGCAAAATATCGAAAGTGATCGGTAGTTGAG
 
. : . : . : . : . : . :
JMSF052E15+ AGTAGCGGCGAAGCGAGATGCTCGAATCCGGTGCAGAAGATCCCGGTGAGCAGAAAAGCG
JMSF029H13+ AGTAGCGGCGAAGCGAGATGCTCGAATCCGGTGCAGAAGATCCCGGTGAGCAGAAAAGCG
JMSF028J22+ AGTAGCGGCGAAGCGAGATGCTCGAATCCGGTGCAGAAGATCCCGGTGAGCAGAAAAGCG
JMSF009F24+ AGTAGCGGCGAAGCGAGATGCTCGAATCCGGTGCAGAAGATCCCGGTGAGCAGAAAAGCG
JMFS134G02+ AGTAGCGGCGAAGCGAGATGCTCGAATCCGGTGCAGAAGATCCCGGTGAGCAGAAAAGCG
                      ____________________________________________________________
consensus AGTAGCGGCGAAGCGAGATGCTCGAATCCGGTGCAGAAGATCCCGGTGAGCAGAAAAGCG
 
. : . : . : . : . : . :
JMSF052E15+ GCACCGCCGTACAGCGACGGCGAACCGTTGCGATGTCGGCGGCGATGAGGTTGAGTGTGA
JMSF029H13+ GCACCGCCGTACAGCGACGGCGAACCGTTGCGATGTCGGCGGCGATGAGGTTGAGTGTGA
JMSF028J22+ GCACCGCCGTACAGCGACGGCGAACCGTTGCGATGTCGGCGGCGATGAGGTTGAGTGTGA
JMSF009F24+ GCACCGCCGTACAGCGACGGCGAACCGTTGCGATGTCGGCGGCGATGAGGCTGAGTGTGA
JMFS134G02+ GCACCGCCGTACAGCGACGGCGAACCGTTGCGATGTCGGCGGCGATGAGGTTGAGTGTGA
                      ____________________________________________________________
consensus GCACCGCCGTACAGCGACGGCGAACCGTTGCGATGTCGGCGGCGATGAGGTTGAGTGTGA
 
. : . : . : . : . : . :
JMSF052E15+ CTAGAGAAAGCGGAAATGACCAAACTGCCAACGGGTGTTTTGAAATCCAGTAATGTC
JMSF029H13+ CTAGAGAAAGCGGAAATGACCAAACTGCCAACGGGTGTTTTGAAATCCAGTAATGTCT
JMSF028J22+ CTAGAGAAAGCGGAAATGACCAAACTGCCAACGGGTGTTTTGAAATCCAGTAATGTCT
JMSF009F24+ CTAGAGAAAGCGGAAATGACCAAACTGCCAACGGGTGTTTTGAAATCCAGTAATGTCT
JMFS134G02+ CTAGAGAAAGCGGAAATGACCAAACTGCCAACGGGTGTTTTGAAATCCAGTAATGTCTAT
                      ____________________________________________________________
consensus CTAGAGAAAGCGGAAATGACCAAACTGCCAACGGGTGTTTTGAAATCCAGTAATGTCTAT
 
. : . : . : . : . : . :
JMFS134G02+ CGTAGTTATAAATTTTTGGCTTTTTAAACTCCGTCAGTGGATTTGGTGCAAGAGTACCCA
                      ____________________________________________________________
consensus CGTAGTTATAAATTTTTGGCTTTTTAAACTCCGTCAGTGGATTTGGTGCAAGAGTACCCA
 
. : . : . : . : . : . :
JMFS134G02+ CGGTGATAGCCTGGGCATTCGTTTTCTCCACCGTTCGATAACAACAACGGTTCAGATTGA
                      ____________________________________________________________
consensus CGGTGATAGCCTGGGCATTCGTTTTCTCCACCGTTCGATAACAACAACGGTTCAGATTGA