Previous Contig 003990:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS023E07Sequence534003990 (8)
JMFS072B11Sequence621003990 (8)pir|T01302|T013024e-07hypothetical protein T14P8.8 - Arabidopsis thaliana>gb:ATCHRIV6_1546236 Arabidop
JMFS093F05Sequence606003990 (8)pir|T01302|T013024e-07hypothetical protein T14P8.8 - Arabidopsis thaliana>gb:ATCHRIV6_1546236 Arabidop
JMFS134E09Sequence609003990 (8)gb:AY090948_15742200.017Arabidopsis thaliana unknown protein (At4g02480) mRNA, complete cds.
JMFS136C04Sequence626003990 (8)pir|T01302|T013022e-07hypothetical protein T14P8.8 - Arabidopsis thaliana>gb:ATCHRIV6_1546236 Arabidop
JMFS140G04Sequence619003990 (8)pir|T01302|T013024e-07hypothetical protein T14P8.8 - Arabidopsis thaliana>gb:ATCHRIV6_1546236 Arabidop
JMSF001E23Sequence360003990 (8)791013023 (2)gb:AY090948_15742201e-84Arabidopsis thaliana unknown protein (At4g02480) mRNA, complete cds.
JMSF036C04Sequence649003990 (8)pir|T01302|T013025e-07hypothetical protein T14P8.8 - Arabidopsis thaliana>gb:ATCHRIV6_1546236 Arabidop742013023 (2)gb:AY090948_15742208e-71Arabidopsis thaliana unknown protein (At4g02480) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS136C04+ CTTTTTTCCCATTTATCTCTAGTAAAGTGCTGGATATACCTTTCTGTGACTC
JMFS140G04+ CTAGTAAAGTGCTGGATATACCTTTCTGTGACTC
JMFS093F05+ GCTGGATATACCTTTCTGTGACTC
JMFS072B11+ CTAGTAAAGTGCTGGATATACCTTTCTGTGACTC
JMSF036C04+ CTAGTAAAGTGCTGGATATACCTTTCTGTGACTC
                      ____________________________________________________________
consensus CTTTTTTCCCATTTATCTCTAGTAAAGTGCTGGATATACCTTTCTGTGACTC
 
. : . : . : . : . : . :
JMFS136C04+ ATTGTGCTTCAGATTACATAAAGATTTACTAACAGATGCATCTCCTATGCACAAGTCACA
JMFS140G04+ ATTGTGCTTCAGATTACATAAAGATTTACTAACAGATGCATCTCCTATGCACAAGTCACA
JMFS093F05+ ATTGTGCTTCAGATTACATAAAGATTTACTAACAGATGCATCTCCTATGCACAAGTCACA
JMFS072B11+ ATTGTGCTTCAGATTACATAAAGATTTACTAACAGATGCATCTCCTATGCACAAGTCACA
JMSF036C04+ ATTGTGCTTCAGATTACATAAAGATTTACTAACAGATGCATCTCCTATGCACAAGTCACA
JMFS134E09+ CAAGTCACA
                      ____________________________________________________________
consensus ATTGTGCTTCAGATTACATAAAGATTTACTAACAGATGCATCTCCTATGCACAAGTCACA
 
. : . : . : . : . : . :
JMFS136C04+ TTGGCGGCCTTGACCGACCGTAAAAGTAGGGTGAAACATGTTAACATGAGGAATTTGAGA
JMFS140G04+ TTGGCGGCCTTGACCGACCGTAAAAGTAGGGTGAAACATGTTAACATGAGGAATTTGAGA
JMFS093F05+ TTGGCGGCCTTGACCGACCGTAAAAGTAGGGTGAAACATGTTAACATGAGGAATTTGAGA
JMFS023E07+ TTTGAGA
JMFS072B11+ TTGGCGGCCTTGACCGACCGTAAAAGTAGGGTGAAACATGTTAACATGAGGAATTTGAGA
JMSF036C04+ TTGGCGGCCTTGACCGACCGTAAAAGTAGGGTGAAACATGTTAACATGAGGAATTTGAGA
JMFS134E09+ TTGGCGGCCTTGACCGACCGTAAAAGTAGGGTGAAACATGTTAACATGAGGAATTTGAGA
                      ____________________________________________________________
consensus TTGGCGGCCTTGACCGACCGTAAAAGTAGGGTGAAACATGTTAACATGAGGAATTTGAGA
 
. : . : . : . : . : . :
JMFS136C04+ ACGCTGAGAAAGAAGTTTTCCCCATGCAGCTCCAATATTAGATTTCAGTTGTCGCTTCCT
JMFS140G04+ ACGCTGAGAAAGAAGTTTTCCCCATGCAGCTCCAATATTAGATTTCAGTTGTCGCTTCCT
JMFS093F05+ ACGCTGAGAAAGAAGTTTTCCCCATGCAGCTCCAATATTAGATTTCAGTTGTCGCTTCCT
JMFS023E07+ ACGCTGAGAAAGAAGTTTTCCCCATGCAGCTCCAATATTAGATTTCAGTTGTCGCTTCCT
JMFS072B11+ ACGCTGAGAAAGAAGTTTTCCCCATGCAGCTCCAATATTAGATTTCAGTTGTCGCTTCCT
JMSF036C04+ ACGCTGAGAAAGAAGTTTTCCCCATGCAGCTCCAATATTAGATTTCAGTTGTCGCTTCCT
JMFS134E09+ ACGCTGAGAAAGAAGTTTTCCCCATGCAGCTCCAATATTAGATTTCAGTTGTCGCTTCCT
                      ____________________________________________________________
consensus ACGCTGAGAAAGAAGTTTTCCCCATGCAGCTCCAATATTAGATTTCAGTTGTCGCTTCCT
 
. : . : . : . : . : . :
JMFS136C04+ TCCCCGAACTAATGCAGACGTATTTGACTTCACCTTGTCCACATCACTTACAGAATCACC
JMFS140G04+ TCCCCGAACTAATGCAGACGTATTTGACTTCACCTTGTCCACATCACTTACAGAATCACC
JMFS093F05+ TCCCCGAACTAATGCAGACGTATTTGACTTCACCTTGTCCACATCACTTACAGAATCACC
JMFS023E07+ TCCCCGAACTAATGCAGACGTATTTGACTTCACCTTGTCCACATCACTTACAGAATCACC
JMFS072B11+ TCCCCGAACTAATGCAGACGTATTTGACTTCACCTTGTCCACATCACTTACAGAATCACC
JMSF036C04+ TCCCCGAACTAATGCAGACGTATTTGACTTCACCTTGTCCACATCACTTACAGAATCACC
JMFS134E09+ TCCCCGAACTAATGCAGACGTATTTGACTTCACCTTGTCCACATCACTTACAGAATCACC
                      ____________________________________________________________
consensus TCCCCGAACTAATGCAGACGTATTTGACTTCACCTTGTCCACATCACTTACAGAATCACC
 
. : . : . : . : . : . :
JMFS136C04+ TCCAACTGAAACCTCAGGCAATTTCTCAGGCTCGACAGCACCTCCCGATTTGAGAACACT
JMFS140G04+ TCCAACTGAAACCTCAGGCAATTTCTCAGGCTCGACAGCACCTCCCGATTTGAGAACACT
JMFS093F05+ TCCAACTGAAACCTCAGGCAATTTCTCAGGCTCGACAGCACCTCCCGATTTGAGAACACT
JMFS023E07+ TCCAACTGAAACCTCAGGCAATTTCTCAGGCTCGACAGCACCTCCCGATTTGAGAACACT
JMFS072B11+ TCCAACTGAAACCTCAGGCAATTTCTCAGGCTCGACAGCACCTCCCGATTTGAGAACACT
JMSF036C04+ TCCAACTGAAACCTCAGGCAATTTCTCAGGCTCGACAGCACCTCCCGATTTGAGAACACT
JMSF001E23+ CAGGCAATTTCTCAGGCTCGACAGCACCTCCCGATTTGAGAACACT
JMFS134E09+ TCCAACTGAAACCTCAGGCAATTTCTCAGGCTCGACAGCACCTCCCGATTTGAGAACACT
                      ____________________________________________________________
consensus TCCAACTGAAACCTCAGGCAATTTCTCAGGCTCGACAGCACCTCCCGATTTGAGAACACT
 
. : . : . : . : . : . :
JMFS136C04+ AGCTTCAGCCAGATCAGCCGATCTAACCTCTTGCTCGGCCGATTCGGGACCTGATTCATT
JMFS140G04+ AGCTTCAGCCAGATCAGCCGATCTAACCTCTTGCTCGGCCGATTCGGGACCTGATTCATT
JMFS093F05+ AGCTTCAGCCAGATCAGCCGATCTAACCTCTTGCTCGGCCGATTCGGGACCTGATTCATT
JMFS023E07+ AGCTTCAGCCAGATCAGCCGATCTAACCTCTTGCTCGGCCGATTCGGGACCTGATTCATT
JMFS072B11+ AGCTTCAGCCAGATCAGCCGATCTAACCTCTTGCTCGGCCGATTCGGGACCTGATTCATT
JMSF036C04+ AGCTTCAGCCAGATCAGCCGATCTAACCTCTTGCTCGGCCGATTCGGGACCTGATTCATT
JMSF001E23+ AGCTTCAGCCAGATCAGCCGATCTAACCTCTTGCTCGGCCGATTCGGGACCTGATTCATT
JMFS134E09+ AGCTTCAGCCAGATCAGCCGATCTAACCTCTTGCTCGGCCGATTCGGGACCTGATTCATT
                      ____________________________________________________________
consensus AGCTTCAGCCAGATCAGCCGATCTAACCTCTTGCTCGGCCGATTCGGGACCTGATTCATT
 
. : . : . : . : . : . :
JMFS136C04+ CAGAACATCCGGTGTTTTCTCCCCAAGCGTGTCATTAGTTGATGACAATGACAACGCCTC
JMFS140G04+ CAGAACATCCGGTGTTTTCTCCCCAAGCGTGTCATTAGTTGATGACAATGACAACGCCTC
JMFS093F05+ CAGAACATCCGGTGTTTTCTCCCCAAGCGTGTCATTAGTTGATGACAATGACAACGCCTC
JMFS023E07+ CAGAACATCCGGTGTTTTCTCCCCAAGCGTGTCATTAGTTGATGACAATGACAACGCCTC
JMFS072B11+ CAGAACATCCGGTGTTTTCTCCCCAAGCGTGTCATTAGTTGATGACAATGACAACGCCTC
JMSF036C04+ CAGAACATCCGGTGTTTTCTCCCCAAGCGTGTCATTAGTTGATGACAATGACAACGCCTC
JMSF001E23+ CAGAACATCCGGTGTTTTCTCCCCAAGCGTGTCATTAGTTGATGACAATGACAACGCCTC
JMFS134E09+ CAGAACATCCGGTGTTTTCTCCCCAAGCGTGTCATTAGTTGATGACAATGACAACGCCTC
                      ____________________________________________________________
consensus CAGAACATCCGGTGTTTTCTCCCCAAGCGTGTCATTAGTTGATGACAATGACAACGCCTC
 
. : . : . : . : . : . :
JMFS136C04+ TGCCGCCTTAGGTCGTTTCCCGTTTGGCAGAGGTGAAGAGGGAGAAGAAAGCGGACGTTT
JMFS140G04+ TGCCGCCTTAGGTCGTTTCCCGTTTGGCAGAGGTGAAGAGGGAGAAGAAAGCGGACGTTT
JMFS093F05+ TGCCGCCTTAGGTCGTTTCCCGTTTGGCAGAGGTGAAGAGGGAGAAGAAAGCGGACGTTT
JMFS023E07+ TGCCGCCTTAGGTCGTTTCCCGTTTGGCAGAGGTGAAGAGGGAGAAGAAAGCGGACGTTT
JMFS072B11+ TGCCGCCTTAGGTCGTTTCCCGTTTGGCAGAGGTGAAGAGGGAGAAGAAAGCGGACGTTT
JMSF036C04+ TGCCGCCTTAGGTCGTTTCCCGTTTGGCAGAGGTGAAGAGGGAGAAGAAAGCGGACGTTT
JMSF001E23+ TGCCGCCTTAGGTCGTTTCCCGTTTGGCAGAGGTGAAGAGGGAGAAGAAAGCGGACGTTT
JMFS134E09+ TGCCGCCTTAGGTCGTTTCCCGTTTGGCAGAGGTGAAGAGGGAGAAGAAAGCGGACGTTT
                      ____________________________________________________________
consensus TGCCGCCTTAGGTCGTTTCCCGTTTGGCAGAGGTGAAGAGGGAGAAGAAAGCGGACGTTT
 
. : . : . : . : . : . :
JMFS136C04+ GGAGGAAGAGGAGCTTCGCCTTGTCTCCACCATGTTCTTCTGATCTTACTCTTCGATCGA
JMFS140G04+ GGAGGAAGAGGAGCTTCGCCTTGTCTCCACCATGTTCTTCTGATCTTACTCTTCGATCGA
JMFS093F05+ GGAGGAAGAGGAGCTTCGCCTTGTCTCCACCATGTTCTTCTGATCTTACTCTTCGATCGA
JMFS023E07+ GGAGGAAGAGGAGCTTCGCCTTGTCTCCACCATGTTCTTCTGATCTTACTCTTCGATCGA
JMFS072B11+ GGAGGAAGAGGAGCTTCGCCTTGTCTCCACCATGTTCTTCTGATCTTACTCTTCGATCGA
JMSF036C04+ GGAGGAAGAGGAGCTTCGCCTTGTCTCCACCATGTTCTTCTGATCTTACTCTTCGATCGA
JMSF001E23+ GGAGGAAGAGGAGCTTCGCCTTGTCTCCACCATGTTCTTCTGATCTTACTCTTCGATCGA
JMFS134E09+ GGAGGAAGAGGAGCTTCGCCTTGTCTCCACCATGTTCTTCTGATCTTACTCTTCGATCGA
                      ____________________________________________________________
consensus GGAGGAAGAGGAGCTTCGCCTTGTCTCCACCATGTTCTTCTGATCTTACTCTTCGATCGA
 
. : . : . : . : . : . :
JMFS136C04+ TCCAGGAACTTGTTGCAGAGAATCAGACGACAGA
JMFS140G04+ TCCAGGAACTTGTTGCAGAGAATCAGACGACAGAGAGTTATACCG
JMFS093F05+ TCCAGGAACTTGTTGCAGAGAATCAGACGACAGAGAGTTATA
JMFS023E07+ TCCAGGAACTTGTTGCAGAGAATCAGACGACAGAG
JMFS072B11+ TCCAGGAACTTGTTGCAGAGAATCAGACGACAGAGAGTTATACCG
JMSF036C04+ TCCAGGAACTTGTTGCAGAGAATCAGACGACAGAGAGTTATACCGATCCCAAATGGATTT
JMSF001E23+ TCCAGGAACTTGTTGCAGAGAATCAGACGACAGAGAGTTATACCGATCCCAAATGGATTT
JMFS134E09+ TCCAGGAACTTGTTGCAGAGAATCAGACGACAGAGAGTTATACCGATCCCAAATGGATTT
                      ____________________________________________________________
consensus TCCAGGAACTTGTTGCAGAGAATCAGACGACAGAGAGTTATACCGATCCCAAATGGATTT
 
. : . : . : . : . : . :
JMSF036C04+ AGGAATGAAATT
JMSF001E23+ AGGAATGAAATT
JMFS134E09+ AGGAATGAAATTTAAGCAAAATTACAGAGAAAACTAAAATAAAATAAACTATTGGGAAGG
                      ____________________________________________________________
consensus AGGAATGAAATTTAAGCAAAATTACAGAGAAAACTAAAATAAAATAAACTATTGGGAAGG