Previous Contig 003985:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS079D03Sequence626003985 (3)gb:AY114165_15785061e-64Cucumis melo alkaline alpha galactosidase II (aga2) mRNA, complete cds.
JMFS079D06Sequence624003985 (3)gb:AY114165_15785061e-64Cucumis melo alkaline alpha galactosidase II (aga2) mRNA, complete cds.
JMFS134C07Sequence616003985 (3)gb:AY114165_15785065e-57Cucumis melo alkaline alpha galactosidase II (aga2) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS079D06+ TACAGAACTATCTCCACTCTCAAAGCAGATCTCCA
JMFS079D03+ TCTACAGAACTATCTCCACTCTCAAAGCAGATCTCCA
JMFS134C07+ TCAAAGCAGATCTCCA
                      ____________________________________________________________
consensus TCTACAGAACTATCTCCACTCTCAAAGCAGATCTCCA
 
. : . : . : . : . : . :
JMFS079D06+ TTTCATTCTTCTCATTGCCTTGAAGAACTGCACGAAATGGTCCTTCAAGGAGCGGGAG-A
JMFS079D03+ TTTCATTCTTCTCATTGCCTTGAAGAACTGCACGAAATGGTCCTTCAAGGAGCGGGAG-A
JMFS134C07+ TTTCATTCTTCTCATGCCCTTGAAGAACTGCACGAAATGGTCCTTCAAGGAGCGGGAGAA
                      ____________________________________________________________
consensus TTTCATTCTTCTCATTGCCTTGAAGAACTGCACGAAATGGTCCTTCAAGGAGCGGGAG-A
 
. : . : . : . : . : . :
JMFS079D06+ AAAACAGTATAGATAGTTGGGGCATCTTCAGGTTCACCTTCACCGGTGTCTTTGCTCTCC
JMFS079D03+ AAAACAGTATAGATAGTTGGGGCATCTTCAGGTTCACCTTCACCGGTGTCTTTGCTCTCC
JMFS134C07+ AAAACAGTATAGATAGTTGGGGCATCTTCAGGTTCACCTTCACCGGTGTCTTTGCTCTCC
                      ____________________________________________________________
consensus AAAACAGTATAGATAGTTGGGGCATCTTCAGGTTCACCTTCACCGGTGTCTTTGCTCTCC
 
. : . : . : . : . : . :
JMFS079D06+ ACAAGCATGAATTGGGTCTCCAGAGGAATATCGTTTCCACATGTTCCCATCCTCTGTGTC
JMFS079D03+ ACAAGCATGAATTGGGTCTCCAGAGGAATATCGTTTCCACATGTTCCCATCCTCTGTGTC
JMFS134C07+ ACAAGCATGAATTGGGTCTCCAGAGGAATATCGTTTCCACATGTTCCCATCCTCTGTGTC
                      ____________________________________________________________
consensus ACAAGCATGAATTGGGTCTCCAGAGGAATATCGTTTCCACATGTTCCCATCCTCTGTGTC
 
. : . : . : . : . : . :
JMFS079D06+ ATCCACCATAGCTTGAAACGGAATAAACACATAAACCGGAGACCCTCTAAGACACCAATG
JMFS079D03+ ATCCACCATAGCTTGAAACGGAATAAACACATAAACCGGAGACCCTCTAAGACACCAATG
JMFS134C07+ ATCCACCATAGCTTGAAACGGAATAAACACATAAACCGGAGACCCTCTAAGACACCAATG
                      ____________________________________________________________
consensus ATCCACCATAGCTTGAAACGGAATAAACACATAAACCGGAGACCCTCTAAGACACCAATG
 
. : . : . : . : . : . :
JMFS079D06+ GGGGAAACATGTAAGCTTTTGCTATGTGAAGCTGTGGCTCCAATGAATGCACCGGCAACA
JMFS079D03+ GGGGAAACATGTAAGCTTTTGCTATGTGAAGCTGTGGCTCCAATGAATGCACCGGCAACA
JMFS134C07+ GGGGAAACATGTAAGCTTTTGCTATGTGAAGCTGTGGCTCCAATGAATGCACCGGCAACA
                      ____________________________________________________________
consensus GGGGAAACATGTAAGCTTTTGCTATGTGAAGCTGTGGCTCCAATGAATGCACCGGCAACA
 
. : . : . : . : . : . :
JMFS079D06+ AGTCCCACACCGGATCCTGGTGTCAGCACAATGTTGTCTGGCACACCTTTAAGCAAGGTC
JMFS079D03+ AGTCCCACACCGGATCCTGGTGTCAGCACAATGTTGTCTGGCACACCTTTAAGCAAGGTC
JMFS134C07+ AGTCCCACACCGGATCCTGGTGTCAGCACAATGTTGTCTGGCACACCTTTAAGCAAGGTC
                      ____________________________________________________________
consensus AGTCCCACACCGGATCCTGGTGTCAGCACAATGTTGTCTGGCACACCTTTAAGCAAGGTC
 
. : . : . : . : . : . :
JMFS079D06+ TTGCCATGGACCACAAGGTTCCCATCAGTGATAGAGATATTGGGTGTGATCGTCATCTTC
JMFS079D03+ TTGCCATGGACCACAAGGTTCCCATCAGTGATAGAGATATTGGGTGTGATCGTCATCTTC
JMFS134C07+ TTGCCATGGACCACAAGGTTCCCATCAGTGATAGAGATATTGGGTGTGATCGTCATCTTC
                      ____________________________________________________________
consensus TTGCCATGGACCACAAGGTTCCCATCAGTGATAGAGATATTGGGTGTGATCGTCATCTTC
 
. : . : . : . : . : . :
JMFS079D06+ GTGCAACTCACTGCTCTTCTACAATAAACTTAATCGAGAAGGAATTCCGTTTATACGCCT
JMFS079D03+ GTGCAACTCACTGCTCTTCTACAATAAACTTAATCGAGAAGGAATTCCGTTTATACGCCT
JMFS134C07+ GTGCAACTCACTGCTCTTCTACAATAAACTTAATCGAGAAGGAATTCCGTTTATACGCCT
                      ____________________________________________________________
consensus GTGCAACTCACTGCTCTTCTACAATAAACTTAATCGAGAAGGAATTCCGTTTATACGCCT
 
. : . : . : . : . : . :
JMFS079D06+ CGCGCGTGTACAGGGAGAGAGAAAGGAGATAAACGCAGACACAATAATATGACTACTCAG
JMFS079D03+ CGCGCGTGTACAGGGAGAGAGAAAGGAGATAAACGCAGACACAATAATATGACTACTCAG
JMFS134C07+ CGCGCGTGTACAGGGAGAGAGAAAGGAGATAAACGCAGACACAATAATATGACTACTCAG
                      ____________________________________________________________
consensus CGCGCGTGTACAGGGAGAGAGAAAGGAGATAAACGCAGACACAATAATATGACTACTCAG
 
. : . : . : . : . : . :
JMFS079D06+ CAGAAGCGCATTCCAGAAGGTAATGCAAACTTCATTAGAGACGAACGGTT
JMFS079D03+ CAGAAGCGCATTCCAGAAGGTAATGCAAACTTCATTAGAGACGAACGGTT
JMFS134C07+ CAGAAGCGCATTCCAGAAGGTAATGCAAACTTCATTAGAGACGAACGGTTTCTTAGCTCC
                      ____________________________________________________________
consensus CAGAAGCGCATTCCAGAAGGTAATGCAAACTTCATTAGAGACGAACGGTTTCTTAGCTCC