Previous Contig 003973:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044N11Sequence629003973 (3)gb:AF509865_18070691e-71Petunia x hybrida nam-like protein 2 (NH2) mRNA, complete cds.
JMFS132F09Sequence617003973 (3)gb:AF509865_18070692e-26Petunia x hybrida nam-like protein 2 (NH2) mRNA, complete cds.
JMSF009G01Sequence382003973 (3)gb:AF509865_18070692e-41Petunia x hybrida nam-like protein 2 (NH2) mRNA, complete cds.722011504 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF044N11+ ATGCCGACCGGGCAGCTTGGCAAT
                      ____________________________________________________________
consensus ATGCCGACCGGGCAGCTTGGCAAT
 
. : . : . : . : . : . :
JMFF044N11+ CNAGTAGGTGCAGGCATAGCAGGAGATACACCAGAAAGATCTGGTTCAGCACATACATCA
                      ____________________________________________________________
consensus CNAGTAGGTGCAGGCATAGCAGGAGATACACCAGAAAGATCTGGTTCAGCACATACATCA
 
. : . : . : . : . : . :
JMFF044N11+ TCATTATCCCAATCTTCCTCAATAAATGGCCTTCCATACTGTGAGCCATTTTTGGGGCCA
                      ____________________________________________________________
consensus TCATTATCCCAATCTTCCTCAATAAATGGCCTTCCATACTGTGAGCCATTTTTGGGGCCA
 
. : . : . : . : . : . :
JMFF044N11+ GATCCAGTCTTCTCAAATACTTTACAGATCACATATGAATCCTGAACAATTCTTGCATCT
                      ____________________________________________________________
consensus GATCCAGTCTTCTCAAATACTTTACAGATCACATATGAATCCTGAACAATTCTTGCATCT
 
. : . : . : . : . : . :
JMFF044N11+ GCCAAATGCTTGTCCTCCATCCGGTACTCATGTATAACCCAATCTGTTCTTATCCCTTTG
JMSF009G01+ G
                      ____________________________________________________________
consensus GCCAAATGCTTGTCCTCCATCCGGTACTCATGTATAACCCAATCTGTTCTTATCCCTTTG
 
. : . : . : . : . : . :
JMFF044N11+ CCCGCATGACCTTGGTGGAAAATTAAAGTTTTAATCTTTCCAACAGTTCGTCCTTTATAA
JMSF009G01+ CCCGCATGACCTTGGTGGAAAATTAAAGTTTTAATCTTTCCAACAGTTCGTCCTTTATAA
                      ____________________________________________________________
consensus CCCGCATGACCTTGGTGGAAAATTAAAGTTTTAATCTTTCCAACAGTTCGTCCTTTATAA
 
. : . : . : . : . : . :
JMFF044N11+ GTAACAGTTCTATCATTCCCTGTGGCTTTCCAGAAACCAGTCTCATTTGCCCGCTTCATT
JMSF009G01+ GTAACAGTTCTATCATTCCCTGTGGCTTTCCAGAAACCAGTCTCATTTGCCCGCTTCATT
JMFS132F09+ CATTTGCCCGCTTCATT
                      ____________________________________________________________
consensus GTAACAGTTCTATCATTCCCTGTGGCTTTCCAGAAACCAGTCTCATTTGCCCGCTTCATT
 
. : . : . : . : . : . :
JMFF044N11+ CTAGACCCACTTGCATACTTCTTTTCTATTGGACAAAAGAAATACCACTCAAGATCTTTA
JMSF009G01+ CTAGACCCACTTGCATACTTCTTTTCTATTGGACAAAAGAAATACCACTCAAGATCTTTA
JMFS132F09+ CTAGACCCACTTGCATACTTCTTTTCTATTGGACAAAAGAAATACCACTCAAGATCTTTA
                      ____________________________________________________________
consensus CTAGACCCACTTGCATACTTCTTTTCTATTGGACAAAAGAAATACCACTCAAGATCTTTA
 
. : . : . : . : . : . :
JMFF044N11+ CTTCTAGATTTTCCAGGAAGCTCCCATGGGGCATAAAGACGAATATTGAGCTCTGGTATA
JMSF009G01+ CTTCTAGATTTTCCAGGAAGCTCCCATGGGGCATAAAGACGAATATTGAGCTCTGGTATA
JMFS132F09+ CTTCTAGATTTTCCAGGAAGCTCCCATGGGGCATAAAGACGAATATTGAGCTCTGGTATA
                      ____________________________________________________________
consensus CTTCTAGATTTTCCAGGAAGCTCCCATGGGGCATAAAGACGAATATTGAGCTCTGGTATA
 
. : . : . : . : . : . :
JMFF044N11+ GCACGCTTAGCTTCAGAATGAAGTTTTCTTCCTGTGACCTTGCGCTTTAGGTAGTACATG
JMSF009G01+ GCACGCTTAGCTTCAGAATGAAGTTTTCTTCCTGTGACCTTGCGCTTTAGGTAGTACATG
JMFS132F09+ GCACGCTTAGCTTCAGAATGAAGTTTTCTTCCTGTGACCTTGCGCTTTAGGTAGTACATG
                      ____________________________________________________________
consensus GCACGCTTAGCTTCAGAATGAAGTTTTCTTCCTGTGACCTTGCGCTTTAGGTAGTACATG
 
. : . : . : . : . : . :
JMFF044N11+ ATCAGCTCTTCATCAGTTGGATGAAAGCGAAATCCTGGAGGAAGGGTTGTATTTGCCATA
JMSF009G01+ ATCAGCTCTTCATCAGTTGGATGAAAGCGAAATCCTGGAGGAAGGGTTGTATTTGCCATA
JMFS132F09+ ATCAGCTCTTCATCAGTTGGATGAAAGCGAAATCCTGGAGGAAGGGTTGTATTTGCCATA
                      ____________________________________________________________
consensus ATCAGCTCTTCATCAGTTGGATGAAAGCGAAATCCTGGAGGAAGGGTTGTATTTGCCATA
 
. : . : . : . : . : . :
JMFF044N11+ CAGTA
JMSF009G01+ CAGTAATGGCGAAAGAACA
JMFS132F09+ CAGTAATGGCGAAAGAACACCACGCAGCTGAGTGAAGTAAATGACCCTCCCTCCCCCCAA
                      ____________________________________________________________
consensus CAGTAATGGCGAAAGAACACCACGCAGCTGAGTGAAGTAAATGACCCTCCCTCCCCCCAA
 
. : . : . : . : . : . :
JMFS132F09+ AAAAAGAAAAAGAAAAAGAATCTAAAGTTCGTTGAGAAGGGAAATACCAACTGACAACAG
                      ____________________________________________________________
consensus AAAAAGAAAAAGAAAAAGAATCTAAAGTTCGTTGAGAAGGGAAATACCAACTGACAACAG
 
. : . : . : . : . : . :
JMFS132F09+ TATTGTCTCCCTTGCACACTGCAGTCAACTAATTGTCAAGTCCAATGCCGAAATAAGATC
                      ____________________________________________________________
consensus TATTGTCTCCCTTGCACACTGCAGTCAACTAATTGTCAAGTCCAATGCCGAAATAAGATC
 
. : . : . : . : . : . :
JMFS132F09+ TTCAGTGCACACCACAACCTTCCCTGATTCATGAAAAAGAAAGAACCCCGAACAAAGAAT
                      ____________________________________________________________
consensus TTCAGTGCACACCACAACCTTCCCTGATTCATGAAAAAGAAAGAACCCCGAACAAAGAAT
 
. : . : . : . : . : . :
JMFS132F09+ CGATGCTTCTCACAAGAATCAATAGACATTTGGAGCACAACACAGACCCGATAGAGGGAA
                      ____________________________________________________________
consensus CGATGCTTCTCACAAGAATCAATAGACATTTGGAGCACAACACAGACCCGATAGAGGGAA
 
. : . : . : . : . : . :
JMFS132F09+ ATGGAGGGAGGAGGGTGACGCGGAAGAAGACGGCGAAAGGCGGAGGAGGGCTAATAGGAA
                      ____________________________________________________________
consensus ATGGAGGGAGGAGGGTGACGCGGAAGAAGACGGCGAAAGGCGGAGGAGGGCTAATAGGAA