Previous Contig 003969:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028B20Sequence516007167 (5)gb:F21E10_16778051e-09Arabidopsis thaliana BAC F21E10, complete sequence.695003969 (6)gb:AY128278_15805807e-07Arabidopsis thaliana At5g26740 mRNA, complete cds.
JMFF041O07Sequence651007167 (5)gb:AC096687_17362213e-94Oryza sativa chromosome 3 BAC OSJNBa0010E04 genomic sequence, complete sequence.414003969 (6)gb:AC096687_17362213e-04Oryza sativa chromosome 3 BAC OSJNBa0010E04 genomic sequence, complete sequence.
JMFS043H07Sequence416003969 (6)gb:AC096687_17362210.001Oryza sativa chromosome 3 BAC OSJNBa0010E04 genomic sequence, complete sequence.
JMFS132B07Sequence623003969 (6)gb:AC096687_17362210.003Oryza sativa chromosome 3 BAC OSJNBa0010E04 genomic sequence, complete sequence.
JMFS165A10Sequence602003969 (6)gb:AC096687_17362210.003Oryza sativa chromosome 3 BAC OSJNBa0010E04 genomic sequence, complete sequence.
JMSF037L06Sequence655007167 (5)gb:AY128278_15805803e-26Arabidopsis thaliana At5g26740 mRNA, complete cds.711003969 (6)gb:AY128278_15805803e-09Arabidopsis thaliana At5g26740 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF037L06+ CCTAAATCAGCCATTGCCTCCTGGAANCACTATAAC
                      ____________________________________________________________
consensus CCTAAATCAGCCATTGCCTCCTGGAANCACTATAAC
 
. : . : . : . : . : . :
rJMSF037L06+ CAAGATTACAAAGTTGCCAGCTTTGCAAGATGATGGGCCCCCAAGTGATTTCTACGGAAG
rJMFF028B20+ TACAAAGTTGCCAGCTTTGCAAGATGATGGGCCCCCAAGTGATTTNTACGGAAG
                      ____________________________________________________________
consensus CAAGATTACAAAGTTGCCAGCTTTGCAAGATGATGGGCCCCCAAGTGATTTCTACGGAAG
 
. : . : . : . : . : . :
rJMSF037L06+ GTTTTCAAACAGGGAAGGGGGCTCACGAGGAGGGTTCAGGGACCGAAGAGGTGGTAGAGG
rJMFF028B20+ GTTTTCAAACAGGGAAGGGGGCTCACGAGGAGGGTTCAGGGACCGAAGAGGTGGTAGAGG
JMFS165A10- GTAGAGG
                      ____________________________________________________________
consensus GTTTTCAAACAGGGAAGGGGGCTCACGAGGAGGGTTCAGGGACCGAAGAGGTGGTAGAGG
 
. : . : . : . : . : . :
rJMSF037L06+ AGCTTCCCGGAGCTGGTCTAGTGGTCGATTCTCCAATAATGATAGTGATGACTTGGATGA
rJMFF028B20+ AGCTTCCCGGAGCTGGTCTAGTGGTCGATTCTCCAATAATGATAGTGATGACTTGGATGA
JMFS165A10- AGCTTCCCGGAGCTGGTCTAGTGGTCGATTCTCCAATAATGATAGTGATGACTTGGATGA
JMFS132B07+ AATGATAGTGATGACTTGGATGA
                      ____________________________________________________________
consensus AGCTTCCCGGAGCTGGTCTAGTGGTCGATTCTCCAATAATGATAGTGATGACTTGGATGA
 
. : . : . : . : . : . :
rJMSF037L06+ TGGGTTTAGGCAGGGTGGGAGATCAAGAAGGGGAGGAAGTAACTTTGATGATGGGTTTAG
rJMFF028B20+ TGGGTTTAGGCAGGGTGGGAGATCAAGAAGGGGAGGAAGTAACTTTGATGATGGGTTTAG
JMFS165A10- TGGGTTTAGGCAGGGTGGGAGATCAAGAAGGGGAGGAAGTAACTTTGATGATGGGTTTAG
JMFS132B07+ TGGGTTTAGGCAGGGTGGGAGATCAAGAAGGGGAGGAAGTAACTTTGATGATGGGTTTAG
                      ____________________________________________________________
consensus TGGGTTTAGGCAGGGTGGGAGATCAAGAAGGGGAGGAAGTAACTTTGATGATGGGTTTAG
 
. : . : . : . : . : . :
rJMSF037L06+ ACAGGGTGGGAGATCAAGAAGGGGAGGAAGTGATTGGCTGATTAGTGATTCGAGATCTAA
rJMFF028B20+ ACAGGGTGGGAGATCAAGAAGGGGAGGAAGTGATTGGCTGATTAGTGATTCGAGATCTAA
JMFS165A10- ACAGGGTGGGAGATCAAGAAGGGGAGGAAGTGATTGGCTGATTAGTGATTCGAGATCTAA
JMFS043H07- GATTAGTGATTCGAGATCTAA
JMFS132B07+ ACAGGGTGGGAGATCAAGAAGGGGAGGAAGTGATTGGCTGATTAGTGATTCGAGATCTAA
                      ____________________________________________________________
consensus ACAGGGTGGGAGATCAAGAAGGGGAGGAAGTGATTGGCTGATTAGTGATTCGAGATCTAA
 
. : . : . : . : . : . :
rJMSF037L06+ CCGGTCATCATCATTCGGAGGAAACAGGGATAGGAACTTCAGTGGTGCATGTTTCAACTG
rJMFF028B20+ CCGGTCATCATCATTCGGAGGAAACAGGGATAGGAACTTCAGTGGTGCATGTTTCAACTG
JMFS165A10- CCGGTCATCATCATTCGGAGGAAACAGGGATAGGAACTTCAGTGGTGCATGTTTCAACTG
JMFS043H07- CCGGTCATCATCATTCGGAGGAAACAGGGATAGGAACTTCAGTGGTGCATGTTTCAACTG
rJMFF041O07+ AGGAACTTCAGTGGTGCATGTTTCAACTG
JMFS132B07+ CCGGTCATCATCATTCGGAGGAAACAGGGATAGGAACTTCAGTGGTGCATGTTTCAACTG
                      ____________________________________________________________
consensus CCGGTCATCATCATTCGGAGGAAACAGGGATAGGAACTTCAGTGGTGCATGTTTCAACTG
 
. : . : . : . : . : . :
rJMSF037L06+ TGGGCAAACTGGTCACCGAGCATATAAATGCCCTAGCAAGCGCGGTGGCTATTAGAACTG
rJMFF028B20+ TGGGCAAACTGGTCACCGAGCATATAAATGCCCTAGCAAGCGCGGTGGCTATTAGAACTG
JMFS165A10- TGGGCAAACTGGTCACCGAGCATATAAATGCCCTAGCAAGCGCGGTGGCTATTAGAACTG
JMFS043H07- TGGGCAAACTGGTCACCGAGCATATAAATGCCCTAGCAAGCGCGGTGGCTATTAGAACTG
rJMFF041O07+ TGGGCAAACTGGTCACCGAGCATATAAATGCCCTAGCAAGCGCGGTGGCTATTAGAACTG
JMFS132B07+ TGGGCAAACTGGTCACCGAGCATATAAATGCCCTAGCAAGCGCGGTGGCTATTAGAACTG
                      ____________________________________________________________
consensus TGGGCAAACTGGTCACCGAGCATATAAATGCCCTAGCAAGCGCGGTGGCTATTAGAACTG
 
. : . : . : . : . : . :
rJMSF037L06+ ATGGTTGTCGAAAACTCCTAAATCTCCCTTTACTGCACTGACTGATGAAAACCTGGAGAT
rJMFF028B20+ ATGGTTGTCGAAAACTCCTAAATCTCCCTTTGCTGCACTGACTGATGAAAACCTGGAGAT
JMFS165A10- ATGGTTGTCGAAAACTCCTAAATCTCCCTTTACTGCACTGACTGATGAAAACCTGGAGAT
JMFS043H07- ATGGTTGTCGAAAACTCCTAAATCTCCCTTTACTGCACTGACTGATGAAAACCTGGAGAT
rJMFF041O07+ ATGGTTGTCGAAAACTCCTAAATCTCCCTTTACTGCACTGACTGATGAAAACCTGGAGAT
JMFS132B07+ ATGGTTGTCGAAAACTCCTAAATCTCCCTTTACTGCACTGACTGATGAAAACCTGGAGAT
                      ____________________________________________________________
consensus ATGGTTGTCGAAAACTCCTAAATCTCCCTTTACTGCACTGACTGATGAAAACCTGGAGAT
 
. : . : . : . : . : . :
rJMSF037L06+ CATTCCTGCAAGCATATCATTCACATTTCACACAGGAGCTGCAGCCAGCTGCAACAACAA
rJMFF028B20+ CATTCCTGCAAGCATATCATTCACATTTCACACAGGAGCTGCAGCCAGCTGCAACAACAA
JMFS165A10- CATTCCTGCAAGCATATCATTCACATTTCACACAGGAGCTGCAGCCAGCTGCAACAACAA
JMFS043H07- CATTCCTGCAAGCATATCATTCACATTTCACACAGGAGCTGCAGCCAGCTGCAACAACAA
rJMFF041O07+ CATTCCTGCAAGCATATCATTCACATTTCACACAGGAGCTGCAGCCAGCTGCAACAACAA
JMFS132B07+ CATTCCTGCAAGCATATCATTCACATTTCACACAGGAGCTGCAGCCAGCTGCAACAACAA
                      ____________________________________________________________
consensus CATTCCTGCAAGCATATCATTCACATTTCACACAGGAGCTGCAGCCAGCTGCAACAACAA
 
. : . : . : . : . : . :
rJMSF037L06+ TTGCTTACTACCCCCCGGTGCCGGTGGTGTATCCTCCAACTTTCTCTAAACCTTATTAGA
rJMFF028B20+ TTGCTTACTACCCCCCGGTGCCGGTGGTGTATCCTCCAACTTTCTCTAAACCTTATTAGA
JMFS165A10- TTGCTTACTACCCCCCGGTGCCGGTGGTGTATCCTCCAACTTTCTCTAAACCTTATTAGA
JMFS043H07- TTGCTTACTACCCCCCGGTGCCGGTGGTGTATCCTCCAACTTTCTCTAAACCTTATTAGA
rJMFF041O07+ TTGCTTACTACCCCCCGGTGCCGGTGGTGTATCCTCCAACTTTCTTTAAACCTTATTAGA
JMFS132B07+ TTGCTTACTACCCCCCGGTGCCGGTGGTGTATCCTCCAACTTTCTCTAAACCTTATTAGA
                      ____________________________________________________________
consensus TTGCTTACTACCCCCCGGTGCCGGTGGTGTATCCTCCAACTTTCTCTAAACCTTATTAGA
 
. : . : . : . : . : . :
rJMSF037L06+ GTGTAGTATGTATAATGTTTAATCTAAATTTTGCTGCTGCTTTTATGCAGACATACTATC
rJMFF028B20+ GTGTAGTATGTATAATGTTTAATCTAAATTTTGCTGCTGCTTTTATGCAGACATACTATC
JMFS165A10- GTGTAGTATGTATAATGTTTAATCTAAATTTTGCTGCTGCTTTTATGCAGACATACTATC
JMFS043H07- GTGTAGTATGTATAATGTTTAATCTAAATTTTGCTGCTGCTTTTATGCAGACATACTATC
rJMFF041O07+ GTGTAGTATGTATAATGTTTAATTTAAATTTTGCTGCTGCTTTTATGCAGACATACTATC
JMFS132B07+ GTGTAGTATGTATAATGTTTAATCTAAATTTTGCTGCTGCTTTTATGCAGACATACTATC
                      ____________________________________________________________
consensus GTGTAGTATGTATAATGTTTAATCTAAATTTTGCTGCTGCTTTTATGCAGACATACTATC
 
. : . : . : . : . : . :
rJMSF037L06+ TATATCTATATCTAT
rJMFF028B20+ TATATCTATATCTATACTTGACACGGTTCAAAATGATATTA
JMFS165A10- TATATCTATATCTATACTTGACACGGTTCAAAATGATATTATGACATTGATTTTT
JMFS043H07- TATATCTATATCTATACTTGACACGGTTCAAAATG
rJMFF041O07+ TATATCTATATCTATACTTGACCCGGTTCAAAATGATATTATGACATTGATTTTTTTTGC
JMFS132B07+ TATATCTATATCTATACTTGACACGGTTCAAAATGATATTATGACATTGATTTTTTCTGC
                      ____________________________________________________________
consensus TATATCTATATCTATACTTGACACGGTTCAAAATGATATTATGACATTGATTTTTTTTGC
 
. : . : . : . : . : . :
rJMFF041O07+ ATTTTATGATGATTTTGTTTCCTGC
JMFS132B07+ ATTTTATGATGATTTTGTTTCCTGCAAAAAAAAAAAAAAAAAAACTCGAGACTAGTTCTC
                      ____________________________________________________________
consensus ATTTTATGATGATTTTGTTTCCTGCAAAAAAAAAAAAAAAAAAACTCGAGACTAGTTCTC