Previous Contig 003967:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF048N03Sequence416003967 (4)pir|T47631|T476311e-20Peptidase-like protein - Arabidopsis thaliana>gb:ATT5N23_1556232 Arabidopsis tha351010851 (2)
JMFS132A02Sequence626003967 (4)pir|T47631|T476315e-09Peptidase-like protein - Arabidopsis thaliana>gb:ATT5N23_1556232 Arabidopsis tha
JMSF033P02Sequence627003967 (4)pir|T47631|T476311e-24Peptidase-like protein - Arabidopsis thaliana>gb:ATT5N23_1556232 Arabidopsis tha
JMSF035H08Sequence630003967 (4)pir|T47631|T476311e-24Peptidase-like protein - Arabidopsis thaliana>gb:ATT5N23_1556232 Arabidopsis tha736010851 (2)pir|T47631|T476315e-27Peptidase-like protein - Arabidopsis thaliana>gb:ATT5N23_1556232 Arabidopsis tha

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035H08+ CCCTCCCGTAGTTCAAAAACACCGCCTTTCCGTACGCCGACCCCGACGGGG
JMFF048N03+ CCCCGACGGGG
JMSF033P02+ TCCCGTAGTTCAAAAACACCGCCTTTCCGTACGCCGACCCCGACGGGG
                      ____________________________________________________________
consensus CCCTCCCGTAGTTCAAAAACACCGCCTTTCCGTACGCCGACCCCGACGGGG
 
. : . : . : . : . : . :
JMSF035H08+ AGTACGCGTGGTACGGCATTACAACGCCGCCGCCGCCGTCTCCCGTAACTCCCGGCTCCG
JMFF048N03+ AGTACGCGTGGTACGGCATTACAACGCCGCCGCCGCCGTCTCCCGTAACTCCCGGCTCCG
JMSF033P02+ AGTACGCGTGGTACGGCATTACAACGCCGCCGCCGCCGTCTCCCGTAACTCCCGGCTCCG
                      ____________________________________________________________
consensus AGTACGCGTGGTACGGCATTACAACGCCGCCGCCGCCGTCTCCCGTAACTCCCGGCTCCG
 
. : . : . : . : . : . :
JMSF035H08+ ACAACGGGACGGGAACATCGGAACCGTTGCTAAAACACGCCGTGACCGAAGCGCTCAGCG
JMFF048N03+ ACAACGGGACGGGAACATCGGAACCGTTGCTAAAACACGCCGTGACCGAAGCGCTCAGCG
JMSF033P02+ ACAACGGGACGGGAACATCGGAACCGTTGCTAAAACACGCCGTGACCGAAGCGCTCAGCG
                      ____________________________________________________________
consensus ACAACGGGACGGGAACATCGGAACCGTTGCTAAAACACGCCGTGACCGAAGCGCTCAGCG
 
. : . : . : . : . : . :
JMSF035H08+ GGTAAGACAGAAGAACGGTGTAGTTAACGACGCGGGTGTCGAGCTTGAGGCGCTCGAAAT
JMFF048N03+ GGTAAGACAGAAGAACGGTGTAGTTAACGACGCGGGTGTCGAGCTTGAGGCGCTCGAAAT
JMSF033P02+ GGTAAGACAGAAGAACGGTGTAGTTAACGACGCGGGTGTCGAGCTTGAGGCGCTCGAAAT
JMFS132A02+ GGTGTCGAGCTTGAGGCGCTCGAAAT
                      ____________________________________________________________
consensus GGTAAGACAGAAGAACGGTGTAGTTAACGACGCGGGTGTCGAGCTTGAGGCGCTCGAAAT
 
. : . : . : . : . : . :
JMSF035H08+ GGGACTTCACATAAACGGCGGCGCCGAGGGACGACGGCGTGCCGGCGAGGTGGGGCCGGC
JMFF048N03+ GGGACTTCACATAAACGGCGGCGCCGAGGGACGACGGCGTGCCGGCGAGGTGGGGCCGGC
JMSF033P02+ GGGACTTCACATAAACGGCGGCGCCGAGGGACGACGGCGTGCCGGCGAGGTGGGGCCGGC
JMFS132A02+ GGGACTTCACATAAACGGCGGCGCCGAGGGACGACGGCGTGCCGGCGAGGTGGGGCCGGC
                      ____________________________________________________________
consensus GGGACTTCACATAAACGGCGGCGCCGAGGGACGACGGCGTGCCGGCGAGGTGGGGCCGGC
 
. : . : . : . : . : . :
JMSF035H08+ CTGTGAGATTGCGAAGATAGGCGGCGATTGTATAGTTCGACGCGGAGGAGATGAAATCAT
JMFF048N03+ CTGTGAGATTGCGAAGATAGGCGGCGATTGTATAGTTCGACGCGGAGGAGATGAAATCAT
JMSF033P02+ CTGTGAGATTGCGAAGATAGGCGGCGATTGTATAGTTCGACGCGGAGGAGATGAAATCAT
JMFS132A02+ CTGTGAGATTGCGAAGATAGGCGGCGATTGTATAGTTCGACGCGGAGGAGATGAAATCAT
                      ____________________________________________________________
consensus CTGTGAGATTGCGAAGATAGGCGGCGATTGTATAGTTCGACGCGGAGGAGATGAAATCAT
 
. : . : . : . : . : . :
JMSF035H08+ TCCTATAATAAAGCCCATTTCTTTTCACCGCCGTGAGGTCGCGGCGGCTGTGGTGGTGCA
JMFF048N03+ TCCTATAATAAAGCCCATTTCTTTTCACCGCCGTGAGGTCGCGGCGGCTGTGGTGGTGCA
JMSF033P02+ TCCTATAATAAAGCCCATTTCTTTTCACCGCCGTGAGGTCGCGGCGGCTGTGGTGGTGCA
JMFS132A02+ TCCTATAATAAAGCCCATTTCTTTTCACCGCCGTGAGGTCGCGGCGGCTGTGGTGGTGCA
                      ____________________________________________________________
consensus TCCTATAATAAAGCCCATTTCTTTTCACCGCCGTGAGGTCGCGGCGGCTGTGGTGGTGCA
 
. : . : . : . : . : . :
JMSF035H08+ GGGTGGCCAAGAAGACTATAATAAACATAACAAAGATCAAACTATACGTAAATTTAAACT
JMFF048N03+ GGGTGGCCAAGAAGACTATAATAAACATAACAAAGATCAAACTAT
JMSF033P02+ GGGTGGCCAAGAAGACTATAATAAACATAACAAAGATCAAACTATACGTAAATTTAAACT
JMFS132A02+ GGGTGGCCAAGAAGACTATAATAAACATAACAAAGATCAAACTATACGTAAATTTAAACT
                      ____________________________________________________________
consensus GGGTGGCCAAGAAGACTATAATAAACATAACAAAGATCAAACTATACGTAAATTTAAACT
 
. : . : . : . : . : . :
JMSF035H08+ TAATCGCCATTTTTGTAGGTGCCCGGAGCATTCAATTCAGAAACAGAGCACAACTGAGAA
JMSF033P02+ TAATCGCCATTTTTGTAGGTGCCCGGAGCATTCAATTCAGAAACAGAGCACAACTGAGAA
JMFS132A02+ TAATCGCCATTTTTGTAGGTGCCCGGAGCATTCAATTCAGAAACGGAGCACAACTGAGAA
                      ____________________________________________________________
consensus TAATCGCCATTTTTGTAGGTGCCCGGAGCATTCAATTCAGAAACAGAGCACAACTGAGAA
 
. : . : . : . : . : . :
JMSF035H08+ TCAAGTGGGGACTTGGGAGCGGCGGAGACCGGCGAGCATGCAGAGACTAATCATTAAAGT
JMSF033P02+ TCAAGTGGGGACTTGGGAGCGGCGGAGACCGGCGAGCATGCAGAGACTAATCATTAAAGT
JMFS132A02+ TCAAGTGGGGACTTGGGAGCGGCGGAGACCGGCGAGCATGCAGAGACTAATCATTAAAGT
                      ____________________________________________________________
consensus TCAAGTGGGGACTTGGGAGCGGCGGAGACCGGCGAGCATGCAGAGACTAATCATTAAAGT
 
. : . : . : . : . : . :
JMSF035H08+ AGTTTGCTTTTTGGCTTTTGCAATTAAAGTGTTTTTT
JMSF033P02+ AGTTTGCTTTTTGGCTTTTGCAATTAAAGTGTTTTTT
JMFS132A02+ AGTTTGCTTTTTGGCTTTTGCAATTAAAGTGTTTTTTCATTTTTTCCAACTTCTTGATAG
                      ____________________________________________________________
consensus AGTTTGCTTTTTGGCTTTTGCAATTAAAGTGTTTTTTCATTTTTTCCAACTTCTTGATAG
 
. : . : . : . : . : . :
JMFS132A02+ GTATATGTGTAAATATGAGTGCTGAAATAGGGAATTTGTTCGTTTTCTTTTTCAGATTAT
                      ____________________________________________________________
consensus GTATATGTGTAAATATGAGTGCTGAAATAGGGAATTTGTTCGTTTTCTTTTTCAGATTAT
 
. : . : . : . : . : . :
JMFS132A02+ GATAATATCATGTTAATTCATCTTTTCTGCATTTATATCTTCATGTATGTATGCAGAAAC
                      ____________________________________________________________
consensus GATAATATCATGTTAATTCATCTTTTCTGCATTTATATCTTCATGTATGTATGCAGAAAC
 
. : . : . : . : . : . :
JMFS132A02+ TGCTAATGATCTCCTTGTCAGAAAGACAGGGACAACCGAACAAATAAAAATGTTTTCTAA
                      ____________________________________________________________
consensus TGCTAATGATCTCCTTGTCAGAAAGACAGGGACAACCGAACAAATAAAAATGTTTTCTAA