Previous Contig 003965:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS131G10Sequence610003965 (2)pir|T52638|T526382e-52exportin 1 [validated] - Arabidopsis thaliana>gb:ATF2K13_1550506 Arabidopsis tha
JMFS136C08Sequence487003965 (2)pir|T52638|T526382e-43exportin 1 [validated] - Arabidopsis thaliana>gb:ATF2K13_1550506 Arabidopsis tha

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS131G10+ ACCAAAATAA
                      ____________________________________________________________
consensus ACCAAAATAA
 
. : . : . : . : . : . :
JMFS131G10+ CATTTAATTTGTTCAGATATAATCTTTCTCGCCGAAGAAATGCTTCATCACTTGAAAGCT
                      ____________________________________________________________
consensus CATTTAATTTGTTCAGATATAATCTTTCTCGCCGAAGAAATGCTTCATCACTTGAAAGCT
 
. : . : . : . : . : . :
JMFS136C08+ TCAGAGATGTAATTTTTCATCCCATCTCGTTGCTCAACAGGCAAAGCAT
JMFS131G10+ TCACAATAAGTTCAGAGATGTAATTTTTCATCCCATCTCGTTGCTCAACAGGCAAAGCAT
                      ____________________________________________________________
consensus TCACAATAAGTTCAGAGATGTAATTTTTCATCCCATCTCGTTGCTCAACAGGCAAAGCAT
 
. : . : . : . : . : . :
JMFS136C08+ TCCATCTATACTTTATGACACCTTCTAGAACCTGTAAAGCAAAAAATTTGGTATTCAAGT
JMFS131G10+ TCCATCTATACTTTATGACACCTTCTAGAACCTGTAAAGCAAAAAATTTGGTATTCAAGT
                      ____________________________________________________________
consensus TCCATCTATACTTTATGACACCTTCTAGAACCTGTAAAGCAAAAAATTTGGTATTCAAGT
 
. : . : . : . : . : . :
JMFS136C08+ TTTGTGTGCTGGATAGGACGTGAACCACTTGAAGCCACATGTCTGGGTTATTTTGCAAAT
JMFS131G10+ TTTGTGTGCTGGATAGGACGTGAACCACTTGAAGCCACATGTCTGGGTTATTTTGCAAAT
                      ____________________________________________________________
consensus TTTGTGTGCTGGATAGGACGTGAACCACTTGAAGCCACATGTCTGGGTTATTTTGCAAAT
 
. : . : . : . : . : . :
JMFS136C08+ CACGCAAAATATGATCAGCAGCAGCCCTCTCCTCCTTAGATCCAGTGCCATAGAAAGCAT
JMFS131G10+ CACGCAAAATATGATCAGCAGCAGCCCTCTCCTCCTTAGATCCAGTGCCATAGAAAGCAT
                      ____________________________________________________________
consensus CACGCAAAATATGATCAGCAGCAGCCCTCTCCTCCTTAGATCCAGTGCCATAGAAAGCAT
 
. : . : . : . : . : . :
JMFS136C08+ TGACAGTGGCGTCAAGCAATGCGACATCAATCGGCTGACTCAAATCCCTAAGCTTCTCCG
JMFS131G10+ TGACAGTGGCGTCAAGCAATGCGACATCAATCGGCTGACTCAAATTCCTAAGCTTCTCCG
                      ____________________________________________________________
consensus TGACAGTGGCGTCAAGCAATGCGACATCAATCGGCTGACTCAAATTCCTAAGCTTCTCCG
 
. : . : . : . : . : . :
JMFS136C08+ CCGCCATGG
JMFS131G10+ CCGCCATGGGAGAGTGATAAACCCTAGAAATCGCAGGAGGGGGAAGAAACCCTAGTTCGA
                      ____________________________________________________________
consensus CCGCCATGGGAGAGTGATAAACCCTAGAAATCGCAGGAGGGGGAAGAAACCCTAGTTCGA
 
. : . : . : . : . : . :
JMFS131G10+ AGGGGCAACCGGCACGGCTACACCTCGGAGAAGAGGACAAATACAGGGAAGCAGTTGTAT
                      ____________________________________________________________
consensus AGGGGCAACCGGCACGGCTACACCTCGGAGAAGAGGACAAATACAGGGAAGCAGTTGTAT
 
. : . : . : . : . : . :
JMFS131G10+ ATATATAAGTATGTATGTATATTTGAAAAGGACAAGAAGACAGCTTCGAATTGAAGCAGC
                      ____________________________________________________________
consensus ATATATAAGTATGTATGTATATTTGAAAAGGACAAGAAGACAGCTTCGAATTGAAGCAGC
 
. : . : . : . : . : . :
JMFS131G10+ AGCAGAAGAAGGAGTTGGAGAGTGAGAGAGAAGACTTTGAAATTGGTTTAAGGGCTTCCC
                      ____________________________________________________________
consensus AGCAGAAGAAGGAGTTGGAGAGTGAGAGAGAAGACTTTGAAATTGGTTTAAGGGCTTCCC