Previous Contig 003960:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011G11Sequence630003960 (7)gb:AY078956_15681113e-09Arabidopsis thaliana AT5g43560/K9D7_6 mRNA, complete cds.796003960 (7)gb:AY078956_15681113e-08Arabidopsis thaliana AT5g43560/K9D7_6 mRNA, complete cds.
JMFS131C09Sequence567003960 (7)gb:AY078956_15681110.002Arabidopsis thaliana AT5g43560/K9D7_6 mRNA, complete cds.
JMSF003N20Sequence118003960 (7)
JMSF019J10Sequence570004014 (12)gb:AY078956_15681114e-69Arabidopsis thaliana AT5g43560/K9D7_6 mRNA, complete cds.768003960 (7)gb:AY078956_15681114e-06Arabidopsis thaliana AT5g43560/K9D7_6 mRNA, complete cds.
JMSF025L04Sequence713004014 (12)gb:AY078956_15681112e-89Arabidopsis thaliana AT5g43560/K9D7_6 mRNA, complete cds.761003960 (7)gb:AY078956_15681115e-09Arabidopsis thaliana AT5g43560/K9D7_6 mRNA, complete cds.
JMSF051B04Sequence589020556762003960 (7)gb:AY078956_15681115e-09Arabidopsis thaliana AT5g43560/K9D7_6 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF011G11- TAC
                      ____________________________________________________________
consensus TAC
 
. : . : . : . : . : . :
JMFF011G11- AAGCCGTCAAACAGTCAAACCCATGATATTTCAGCTCAGTCGCTAGCATGCACATCTGGA
rJMSF025L04+ CGCTAGCATGCACATCTGGA
rJMSF051B04+ CGCTAGCATGCACATCTGGA
                      ____________________________________________________________
consensus AAGCCGTCAAACAGTCAAACCCATGATATTTCAGCTCAGTCGCTAGCATGCACATCTGGA
 
. : . : . : . : . : . :
JMFF011G11- CGTCCGTCCCAGAGTGTACTGGCAGATGAA-TTTCCTCATCTTGACATTATTAATGACCT
rJMSF025L04+ CGTCCGTCCCAGAGTGTACTGGCAGATGAA-TTTCCTCATCTTGACATTATTAATGACCT
rJMSF051B04+ CGTCCGTCCCAGAGTGTACTGGCAGATGAA-TTTCCTCATCTNGACATTATTAATGACCT
rJMSF019J10+ CGTCCCAGAGTGTACTGGCAGATGAANTTTCCTCATCTTGACATTATTAATGACCT
rJMFF011G11+ CGTCCGTCCCAGAGTGTACTGGCAGATGAA-TTTCCTCATCTTGACATTATTAATGACCT
                      ____________________________________________________________
consensus CGTCCGTCCCAGAGTGTACTGGCAGATGAA-TTTCCTCATCTTGACATTATTAATGACCT
 
. : . : . : . : . : . :
JMFF011G11- GCTGGATGATGATCTTGGAATTGGGATGGCTTCTGGACTGGAGCCAAGCTTTCAAAGTTT
rJMSF025L04+ GCTGGATGATGATCTTGGAATTGGGATGGCTTCTGGACTGGATCCAAGCTTTCAAAGTTT
rJMSF051B04+ GCTGGATGATGATCTTGGAATTGGGATGGCTTCTGGACTGGATCCAAGCTTTCAAAGTTT
rJMSF019J10+ GCTGGATGATGATCTTGGAATTGGGATGGCTTCTGGACTGGATCCAAGCTTTCAAAGTTT
rJMFF011G11+ GCTGGATGATGATCTTGNAATTGGGATGGCTTCTGGACTGGATCCAAGCTTTCAAAGTTT
                      ____________________________________________________________
consensus GCTGGATGATGATCTTGGAATTGGGATGGCTTCTGGACTGGATCCAAGCTTTCAAAGTTT
 
. : . : . : . : . : . :
JMFF011G11- TAGCAATGGTCCTCACCATCATCTAGCTCGGCATTTCACCTTCCCAGGTGATGTTGGTTC
rJMSF025L04+ TAGCAATGGTCCTCACCATCATCTAGCTCGGCATTTCACCTTCCCAGGTGATGTTGGTTC
rJMSF051B04+ TAGCAATGGTCCTCACCATCATCTAGCTCGGCATTTCACCTTCCCAGGTGATGTTGGTTC
rJMSF019J10+ TAGCAATGGTCCTCACCATCATCTAGCTCGGCATTTCACCTTCCCAGGTGATGTTGGTTC
rJMFF011G11+ TAGCAATGGTCCTCACCATCATCTAGCTCGGCATTTCACCTTCCCAGGTGATGTTGGTTC
                      ____________________________________________________________
consensus TAGCAATGGTCCTCACCATCATCTAGCTCGGCATTTCACCTTCCCAGGTGATGTTGGTTC
 
. : . : . : . : . : . :
JMFF011G11- AGCTGACCTAGGTCCATCTACTAGCTCTTGTAGGTTAGAGCGGACACTGAGCTATCATGA
rJMSF025L04+ AGCTGACCTAGGTCCATCTACTAGCTCTTGTAGGTTAGAGCGGACACTGAGCTATCATGA
rJMSF051B04+ AGCTGACCTAGGTCCATCTACTAGCTCTTGTAGGTTAGAGCGGACACTGAGCTATCATGA
rJMSF019J10+ AGCTGACCTAGGTCCATCTACTAGCTCTTGTAGGTTAGAGCGGACACTGAGCTATCATGA
rJMFF011G11+ AGCTGACCTAGGTCCATCTACTAGCTCTTGTAGGTTAGAGCGGACACTGAGCTATCATGA
                      ____________________________________________________________
consensus AGCTGACCTAGGTCCATCTACTAGCTCTTGTAGGTTAGAGCGGACACTGAGCTATCATGA
 
. : . : . : . : . : . :
JMFF011G11- TAATGGGTTCCTACATAGGTATCCAGGGGGAGGCCATTTTGATACTGGTAGAGATATGAT
rJMSF025L04+ TAATGGGTTCCTACATAGGTATCCAGGGGGAGGCCATTTTGATACTGGTAGAGATATGAT
rJMSF051B04+ TAATGGGTTCCTACATAGGTATCCAGGGGGAGGCCATTTTGATACTGGTAGAGATATGAT
rJMSF019J10+ TAATGGGTTCCTACATAGGTATCCAGGGGGAGGCCATTTTGATACTGGTAGAGATATGAT
rJMFF011G11+ TAATGGGTTCCTACATAGGTATCCAGGGGGAGGCCATTTTGATACTGGTAGAGATATGAT
JMFS131C09+ CCATTTTGATACTGGTAGAGATATGAT
                      ____________________________________________________________
consensus TAATGGGTTCCTACATAGGTATCCAGGGGGAGGCCATTTTGATACTGGTAGAGATATGAT
 
. : . : . : . : . : . :
JMFF011G11- AGCGCAGCCTAGTCCACAAAGTTATGTGAATGGGCAGATGGATGGAATAATTCCTAGCCA
rJMSF025L04+ AGCGCAGCCTAGTCCACAAAGTTATGTGAATGGGCAGATGGATGGAATAATTCCTAGCCA
rJMSF051B04+ AGCGCAGCCTAGTCCACAAAGTTATGTGAATGGGCAGATGGATGGAATAATTCCTAGCCA
rJMSF019J10+ AGCGCAGCCTAGTCCACAAAGTTATGTGAATGGGCAGATGGATGGAATAATTCCTAGCCA
rJMFF011G11+ AGCGCAGCCTAGTCCACAAAGTTATGTGAATGGGCAGATGGATGGAATAATTCCTAGCCA
JMFS131C09+ AGCGCAGCCTAGTCCACAAAGTTATGTGAATGGGCAGATGGATGGAATAATTCCTAGCCA
                      ____________________________________________________________
consensus AGCGCAGCCTAGTCCACAAAGTTATGTGAATGGGCAGATGGATGGAATAATTCCTAGCCA
 
. : . : . : . : . : . :
JMFF011G11- ATGGCAGATGGTTGCTTCTGATGCATCTTACCTTGGAATGAGGAGTGCTGATAGTGATGT
rJMSF025L04+ ATGGCAGATGGTTGCTTCTGATGCATCTTACCTTGGAATGAGGAGTGCTGATAGTGATGT
rJMSF051B04+ ATGGCAGATGGTTGCTTCTGATGCATCTTACCTTGGAATGAGGAGTGCTGATAGTGATGT
rJMSF019J10+ ATGGCAGATGGTTGCTTCTGATGCATCTTACCTTGGAATGAGGAGTGCTGATAGTGATGT
rJMFF011G11+ ATGGCAGATGGTTGCTTCTGATGCATCTTACCTTGGAATGAGGAGTGCTGATAGTGATGT
JMFS131C09+ ATGGCAGATGGTTGCTTCTGATGCATCTTACCTTGGAATGAGGAGTGCTGATAGTGATGT
                      ____________________________________________________________
consensus ATGGCAGATGGTTGCTTCTGATGCATCTTACCTTGGAATGAGGAGTGCTGATAGTGATGT
 
. : . : . : . : . : . :
JMFF011G11- TGGCTACCCGTATCATGTCCCTGATTATTCAAACATGGCATGTGGTTTCAATGGTTATAC
rJMSF025L04+ TGGCTACCCGTATCATGTCCCTGATTATTCAAACATGGCATGTGGTTTCAATGGTTATAC
rJMSF051B04+ TGGCTACCCGTATCATGTCCCTGATTATTCAAACATGGCATGTGGTTTCAATGGTTATAC
rJMSF019J10+ TGGCTACCCGTATCATGTCCCTGATTATTCAAACATGGCATGTGGTTTCAATGGTTATAC
rJMFF011G11+ TGGCTACCCGTATCATGTCCCTGATTATTCAAACATGGCATGTGGTTTCAATGGTTATAC
JMFS131C09+ TGGCTACCCGTATCATGTCCCTGATTATTCAAACATGGCATGTGGTTTCAATGGTTATAC
                      ____________________________________________________________
consensus TGGCTACCCGTATCATGTCCCTGATTATTCAAACATGGCATGTGGTTTCAATGGTTATAC
 
. : . : . : . : . : . :
JMFF011G11- AATGTTCCGGCCTTCAAATGGGCTCTGAAGGAGGGTGGGTCTTATGCAGCTTTGCCTAGG
rJMSF025L04+ AATGTTCCGGCCTTCAAATGGGCTCTGAAGGAGGGTGGGTCTTATGCAGCTTTGCCTAGG
rJMSF051B04+ AATGTTCCGGCCTTCAAATGGGCTCTGAAGGAGGGTGGGTCTTATGCAGCTTTGCCTAGG
rJMSF019J10+ AATGTTCCGGCCTTCAAATGGGCTCTGAAGGAGGGTGGGTCTTATGCAGCTTTGCCTAGG
rJMFF011G11+ AATGTTCCGGCCTTCAAATGGGCTCTGAAGGAGGGTGGGTCTTATGCAGCTTTGCCTAGG
JMFS131C09+ AATGTTCCGGCCTTCAAATGGGCTCTGAAGGAGGGTGGGTCTTATGCAGCTTTGCCTAGG
                      ____________________________________________________________
consensus AATGTTCCGGCCTTCAAATGGGCTCTGAAGGAGGGTGGGTCTTATGCAGCTTTGCCTAGG
 
. : . : . : . : . : . :
JMFF011G11- AATGAATATATGGGCTGGTGTCCCCATT
rJMSF025L04+ AATGAATATATGGGCTGGTGTCCCCATTGTGATAAAAGAATGCTTTGGTCTTAGATTTGG
rJMSF051B04+ AATGAATATATGGGCTGGTGTCCCCATTGTGATAAAAGAATGCTTTGGTCTTAGATTTGG
rJMSF019J10+ AATGAATATATGGGCTGGTGTCCCCATTGTGATAAAAGAATGCTTTGGTCTTAGATTTGG
rJMFF011G11+ AATGAATATATGGGCTGGTGTCCCCATTGTGATAAAAGAATGCTTTGGTCTTAGATTTGG
JMFS131C09+ AATGAATATATGGGCTGGTGTCCCCATTGTGATAAAAGAATGCTTTGGTCTTAGATTTGG
                      ____________________________________________________________
consensus AATGAATATATGGGCTGGTGTCCCCATTGTGATAAAAGAATGCTTTGGTCTTAGATTTGG
 
. : . : . : . : . : . :
rJMSF025L04+ AGTGAAGTGTCACCCTAAAAAGGTAAGGCAACATTTTGTAAAGAGTGATTTTGCGTTTTA
rJMSF051B04+ AGTGAAGTGTCACCCTAAAAAGGTAAGGCAACATTTTGTAAAGAGTGATTTTGCGTTTTA
rJMSF019J10+ AGTGAAGTGTCACCCTAAAAAGGTAAGGCAACATTTTGTAAAGAGTGATTTTGCGTTTTA
rJMFF011G11+ AGTGAAGTGTCACCCTAAAAAGGTAAGGCAACATTTTGTAAAGAGTGATTTTGCGTTTTA
JMFS131C09+ AGTGAAGTGTCACCCTAAAAAGGTAAGGCAACATTTTGTAAAGAGTGATTTTGCGTTTTA
                      ____________________________________________________________
consensus AGTGAAGTGTCACCCTAAAAAGGTAAGGCAACATTTTGTAAAGAGTGATTTTGCGTTTTA
 
. : . : . : . : . : . :
rJMSF025L04+ TGTTCACAACTTTTAGGTTTTAAAAACGCTATCGCCCCCCATATTGGGGATTTGATGTTT
rJMSF051B04+ TGTTCACAACTTTTAGGTTTTAAAAACGCTATCGCCCCCCATATTGGGGATTTGATGTTT
rJMSF019J10+ TGTTCACAACTTTTAGGTTTTAAAAACGCTATCGCCCCCCATATTGGGGATTTGATGTTT
rJMFF011G11+ TGTTCACAACTTTTAGGTTTTAAAAACGCTATCGCCCCCCATATTGGGGATTTGATGTTT
JMSF003N20- TTGATGTTT
JMFS131C09+ TGTTCACAACTTTTAGGTTTTAAAAACGCTATCGCCCCCCATATTGGGGATTTGATGTTT
                      ____________________________________________________________
consensus TGTTCACAACTTTTAGGTTTTAAAAACGCTATCGCCCCCCATATTGGGGATTTGATGTTT
 
. : . : . : . : . : . :
rJMSF025L04+ GCGAAGTTCATGCTTGTCT
rJMSF051B04+ GCGAAGTTCATGCTTGTCTTGCT
rJMSF019J10+ GCGAAGTTCATGCTTGTCTTGCTTCTTTTGACCAAATAAGAGCAAATGAGTC
rJMFF011G11+ GCGAAGTTCATGCTTGTCTTGCTTCTTTTGACCAAATAAGAGCAAATGAGTCTAACCTTT
JMSF003N20- GCGAAGTTCATGCTTGTCTTGCTTCTTTTGACCAAATAAGAGCAAATGAGTCTAACCTTT
JMFS131C09+ GCGAAGTTCATGCTTGTCTTGCTTCTTTTGACCAAATAAGAGCAAATGAGTCTAACCTTT
                      ____________________________________________________________
consensus GCGAAGTTCATGCTTGTCTTGCTTCTTTTGACCAAATAAGAGCAAATGAGTCTAACCTTT
 
. : . : . : . : . : . :
rJMFF011G11+ TATTTACTGATGATATA
JMSF003N20- TATTTACTGATGATATATGATATATGATATATGCCCA
JMFS131C09+ TATTTACTGATGATATATGATATATGATATATGCCCACTTGGTAGTAGGGGTGAGTGATC
                      ____________________________________________________________
consensus TATTTACTGATGATATATGATATATGATATATGCCCACTTGGTAGTAGGGGTGAGTGATC