Previous Contig 003958:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN034N18Sequence633003958 (6)pir|E96582|E965824e-50hypothetical protein F15I1.24 [imported] - Arabidopsis thaliana>gb:AE005173_8933
JMFS131C06Sequence616003958 (6)pir|E96582|E965826e-41hypothetical protein F15I1.24 [imported] - Arabidopsis thaliana>gb:AE005173_8933
JMSF030M04Sequence616003958 (6)pir|E96582|E965827e-57hypothetical protein F15I1.24 [imported] - Arabidopsis thaliana>gb:AE005173_8933755003958 (6)pir|E96582|E965828e-49hypothetical protein F15I1.24 [imported] - Arabidopsis thaliana>gb:AE005173_8933
JMSF050O17Sequence616003958 (6)pir|E96582|E965827e-57hypothetical protein F15I1.24 [imported] - Arabidopsis thaliana>gb:AE005173_8933757003958 (6)pir|E96582|E965829e-54hypothetical protein F15I1.24 [imported] - Arabidopsis thaliana>gb:AE005173_8933

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF030M04- TATTCTCAAACAATGAAATCAAGGGCTAATACACAGCTAAGGAAAT
rJMSF050O17- ATTCTCAAACAATGAAATCAAGGGCTAATACACAGCTAAGGAAAT
                      ____________________________________________________________
consensus TATTCTCAAACAATGAAATCAAGGGCTAATACACAGCTAAGGAAAT
 
. : . : . : . : . : . :
rJMSF030M04- AGAGAAGAAATGGAGTTAGATTATCAGACATGAGGACACCTTAACTTATGCTATATATAT
rJMSF050O17- AGAGAAGAAATGGAGTTAGATTATCAGACATGAGGACACCTTAACTTATGCTATATATAT
                      ____________________________________________________________
consensus AGAGAAGAAATGGAGTTAGATTATCAGACATGAGGACACCTTAACTTATGCTATATATAT
 
. : . : . : . : . : . :
rJMSF030M04- GTTCTTGGGCATAATTGCCTTTCAGAAAGTGCACGAAAAAGATTAGGTTCTGTCAATAAA
rJMSF050O17- GTTCTTGGGCATAATTGCCTTTCAGAAAGTGCACGAAAAAGATTAGGTTCTGTCAATAAA
                      ____________________________________________________________
consensus GTTCTTGGGCATAATTGCCTTTCAGAAAGTGCACGAAAAAGATTAGGTTCTGTCAATAAA
 
. : . : . : . : . : . :
rJMSF030M04- ATTAACATTATAGCACAACATAAGCTCTAACTAGTTACAGCAAAATAGCAAAAGGTTTTC
rJMSF050O17- ATTAACATTATAGCACAACATAAGCTCTAACTAGTTACAGCAAAATAGCAAAAGGTTTTC
                      ____________________________________________________________
consensus ATTAACATTATAGCACAACATAAGCTCTAACTAGTTACAGCAAAATAGCAAAAGGTTTTC
 
. : . : . : . : . : . :
rJMSF030M04- TTCAGACTCCTTGCAACTAAAAGATGGTGGAAGGTGACAAGAGTGTCATCTTGGTCGTTT
rJMSF050O17- TTCAGACTCCTTGCAACTAAAAGATGGTGGAAGGTGACAAGAGTGTCATCTTGGTCGTTT
                      ____________________________________________________________
consensus TTCAGACTCCTTGCAACTAAAAGATGGTGGAAGGTGACAAGAGTGTCATCTTGGTCGTTT
 
. : . : . : . : . : . :
rJMSF030M04- AGCTCCAAGGGGAAAAGAGACTCGCTGAGGAGCCTCTTGAGGCACATCTGTCCGATCTTG
rJMSF050O17- AGCTCCAAGGGGAAAAGAGACTCGCTGAGGAGCCTCTTGAGGCACATCTGTCCGATCTTG
                      ____________________________________________________________
consensus AGCTCCAAGGGGAAAAGAGACTCGCTGAGGAGCCTCTTGAGGCACATCTGTCCGATCTTG
 
. : . : . : . : . : . :
rJMSF030M04- GGAAAGATTTTGGTTTTGGTTAGATGCGGGATTAGGATCGGAACCCTCTTCCTCCTCAGT
rJMSF050O17- GGAAAGATTTTGGTTTTGGTTAGATGCGGGATTAGGATCGGAACCCTCTTCCTCCTCAGT
                      ____________________________________________________________
consensus GGAAAGATTTTGGTTTTGGTTAGATGCGGGATTAGGATCGGAACCCTCTTCCTCCTCAGT
 
. : . : . : . : . : . :
rJMSF030M04- TTCTTCCACATGTTGAGCAGTTCGTTTCTTGGGAATAGCAAGTTGATAGTTGGGGCTGAT
rJMSF050O17- TTCTTCCACATGTTGAGCAGTTCGTTTCTTGGGAATAGCAAGTTGATAGTTGGGGCTGAT
JMSF050O17+ TTCTTCCACATGTTGAGCAGTTCGTTTCTTGGGAATAGCAAGTTGATAGTTGGGGCTGAT
JMSF030M04+ TTCTTCCACATGTTGAGCAGTTCGTTTCTTGGGAATAGCAAGTTGATAGTTGGGGCTGAT
JMFN034N18+ GGCTGAT
                      ____________________________________________________________
consensus TTCTTCCACATGTTGAGCAGTTCGTTTCTTGGGAATAGCAAGTTGATAGTTGGGGCTGAT
 
. : . : . : . : . : . :
rJMSF030M04- CAAGGTATCTTGTTCAGGAGGCAGTGGGATTCCAGGTCCTGAAATTGATTTTGGAAGAGG
rJMSF050O17- CAAGGTATCTTGTTCAGGAGGCAGTGGGATTCCAGGTCCTGAAATTGATTTTGGAAGAGG
JMSF050O17+ CAAGGTATCTTGTTCAGGAGGCAGTGGGATTCCAGGTCCTGAAATTGATTTTGGAAGAGG
JMSF030M04+ CAAGGTATCTTGTTCAGGAGGCAGTGGGATTCCAGGTCCTGAAATTGATTTTGGAAGAGG
JMFN034N18+ CAGGGTATCTTGTTCAGGAGGCAGTGGGATCCCAGGTCCTGAAATTGATTTTGGCAGAGG
JMFS131C06+ GGTCCTGAAATTGATTTTGGCAGAGG
                      ____________________________________________________________
consensus CAAGGTATCTTGTTCAGGAGGCAGTGGGATTCCAGGTCCTGAAATTGATTTTGGAAGAGG
 
. : . : . : . : . : . :
rJMSF030M04- AATTTTGTTTCTGCTTCGAGCCAACTCTAACAGGACCTCTCTGGGAGGGGGTGGAGCAAA
rJMSF050O17- AATTTTGTTTCTGCTTCGAGCCAACTCTAACAGGACCTCTCTGGGAGGGGGTGGAGCAAA
JMSF050O17+ AATTTTGTTTCTGCTTCGAGCCAACTCTAACAGGACCTCTCTGGGAGGGGGTGGAGCAAA
JMSF030M04+ AATTTTGTTTCTGCTTCGAGCCAACTCTAACAGGACCTCTCTGGGAGGGGGTGGAGCAAA
JMFN034N18+ AATTTTGTTTCTGCTTCGAGCCAACTCTAACAGGACCTCTCTGGGAGGGGGTGGAGCAAA
JMFS131C06+ AATTTTGTTTCTGCTTCGAGCCAACTCTAACAGGACCTCTCTGGGAGGGGGTGGAGCANA
                      ____________________________________________________________
consensus AATTTTGTTTCTGCTTCGAGCCAACTCTAACAGGACCTCTCTGGGAGGGGGTGGAGCAAA
 
. : . : . : . : . : . :
rJMSF030M04- GCTAAAATTAACTTTAGACTGAACTGCAAGCTTGAGATCATCAGAGTCTATCACAGTCTT
rJMSF050O17- GCTAAAATTAACTTTAGACTGAACTGCAAGCTTGAGATCATCAGAGTCTATCACAGTCTT
JMSF050O17+ GCTAAAATTAACTTTAGACTGAACTGCAAGCTTGAGATCATCAGAGTCTATCACAGTCTT
JMSF030M04+ GCTAAAATTAACTTTAGACTGAACTGCAAGCTTGAGATCATCAGAGTCTATCACAGTCTT
JMFN034N18+ GCTAAAATTAACTTTAGACTGAACTGCAAGCTTGAGATCATCAGAGTCTATCACAGTCTT
JMFS131C06+ GCTAAAATTAACTTTAGACTGAACTGCAAGCTTGAGATCATCAGAGTCTATCACAGTCTT
                      ____________________________________________________________
consensus GCTAAAATTAACTTTAGACTGAACTGCAAGCTTGAGATCATCAGAGTCTATCACAGTCTT
 
. : . : . : . : . : . :
rJMSF030M04- GGCAGCATGCTCCGAGTACACCTGTGCATCCATCAACACATCAACAGCATGCCTATACAT
rJMSF050O17- GGCAGCATGCTCCGAGTACACCTGTGCATCCATCAACACATCAACAGCATGCCTATACAT
JMSF050O17+ GGCAGCATGCTCCGAGTACACCTGTGCATCCATCAACACATCAACAGCATGCCTATACAT
JMSF030M04+ GGCAGCATGCTCCGAGTACACCTGTGCATCCATCAACACATCAACAGCATGCCTATACAT
JMFN034N18+ GCCAGCATGCTCCGAGTACACCTGTGCATCCATCAACACATCAACAGCATGCCTATACAT
JMFS131C06+ GCCAGCATGCTCCGAGTACACCTGTGCATCCATCAACACATCAACAGCATGCCTATACAT
                      ____________________________________________________________
consensus GGCAGCATGCTCCGAGTACACCTGTGCATCCATCAACACATCAACAGCATGCCTATACAT
 
. : . : . : . : . : . :
rJMSF030M04- AAGCTCCAGGAACTGGTGGACC-CACGTGGTCCGTACTCTTCA
rJMSF050O17- AAGCTCCAGGAACTGGTGGACCACACGTGGTTCGTACTCTTCACCACCCAT
JMSF050O17+ AAGCTCCAGGAACTGGTGGACCACACGTGGTTCGTACTCTTCAACACCCATTGATTTGAG
JMSF030M04+ AAGCTCCAGGAACTGGTGGACCACACGTGGTTCGTACTCTTCAACACCCATTGATTTGAG
JMFN034N18+ AAGCTCCAGGAACTGGTGGACCACACGTGGTTCGTACTCTTCAACACCCATTGATTTGAG
JMFS131C06+ AAGCTCCAGGAACTGGTGGACCACACGTGGTTCGTACTCTTCAACACCCATTGATTTGAG
                      ____________________________________________________________
consensus AAGCTCCAGGAACTGGTGGACCACACGTGGTTCGTACTCTTCAACACCCATTGATTTGAG
 
. : . : . : . : . : . :
JMSF050O17+ TAGGGTTTTCACCACCTTTGCATCCCTTGGCAAGTCCTCTTCAGCTCCTTCTGCCATTTG
JMSF030M04+ TAGGGTTTTCACCACCTTTGCATCCCTTGGCAAGTCCTCTTCAGCTCCTTCTGCCATTTG
JMFN034N18+ TAGGGTTTTCACCACCTTTGCATCCCTTGGCAAGTCCTCTTCAGCTCCTTCTGCCATTTG
JMFS131C06+ TAGGGTTTTCACCACCTTTGCATCCCTTGGCAAGTCCTCTTCAGCTCCTTCTGCCATTTG
                      ____________________________________________________________
consensus TAGGGTTTTCACCACCTTTGCATCCCTTGGCAAGTCCTCTTCAGCTCCTTCTGCCATTTG
 
. : . : . : . : . : . :
JMSF050O17+ CCTCTACTCTATATCCTTCTACCCCTCTGTGTGGCCAAATAATTCAATCCAACCACCACA
JMSF030M04+ CCTCTACTCTATATCCTTCTACCCCTCTGTGTGGCCAAATAATTCAATCCAACCACCACA
JMFN034N18+ CCTCTAC----------TCTACCCCTCTGTGTGGCCAAAAAATTCAATCCAACCACCACA
JMFS131C06+ CCTCTAC----------TCTACCCCTCTGTGTGGCCAAAAAATTCAATCCAACCACCACA
                      ____________________________________________________________
consensus CCTCTACTCTATATCCTTCTACCCCTCTGTGTGGCCAAATAATTCAATCCAACCACCACA
 
. : . : . : . : . : . :
JMSF050O17+ GTAGTCTGTAGATTTTCAACTT
JMSF030M04+ GTAGTCTGTAGATTTTCAACTT
JMFN034N18+ GTAGTCTGTAGATTTTCAACTTCGTCGTCGACAGTAGAGGAGACCGTTGGTCGCTAGGAG
JMFS131C06+ GTAGTCTGTAGATTTTCAACTTCGTCGTCGACAGTAGAGGAGACCGTTGGTCGCTAGGAG
                      ____________________________________________________________
consensus GTAGTCTGTAGATTTTCAACTTCGTCGTCGACAGTAGAGGAGACCGTTGGTCGCTAGGAG
 
. : . : . : . : . : . :
JMFN034N18+ CATGCGAGGAACGGAGGCGGCGGAGCACGGCAGCCGGCAGCAGGCGAGGCGGGAGATGGA
JMFS131C06+ CATGCGAGGAACGGAGGCGGCGGAGCACGGCAGCCGGCAGCAGGCGAGGCGGGAGATGGA
                      ____________________________________________________________
consensus CATGCGAGGAACGGAGGCGGCGGAGCACGGCAGCCGGCAGCAGGCGAGGCGGGAGATGGA
 
. : . : . : . : . : . :
JMFN034N18+ GGACTTGTCTCTGGTCTCTGGTC
JMFS131C06+ GGACTTGTCTCTGGTCTCTGGTCTCTGGTCCCTGGTCCCTGGTCCCTGGTCCGGTGACGA
                      ____________________________________________________________
consensus GGACTTGTCTCTGGTCTCTGGTCTCTGGTCCCTGGTCCCTGGTCCCTGGTCCGGTGACGA
 
. : . : . : . : . : . :
JMFS131C06+ GAAGGTTAGGGATTTGGAGATGGAATTTTGGATCAACTGACCGGCGATTTGGAGATGGGA
                      ____________________________________________________________
consensus GAAGGTTAGGGATTTGGAGATGGAATTTTGGATCAACTGACCGGCGATTTGGAGATGGGA