Previous Contig 003955:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS055E04Sequence627003955 (5)gb:BT006177_16390698e-73Arabidopsis thaliana clone RAFL15-48-I15 (R20938) unknown protein (At3g20720) mR
JMFS063B09Sequence642003955 (5)gb:BT006177_16390694e-66Arabidopsis thaliana clone RAFL15-48-I15 (R20938) unknown protein (At3g20720) mR
JMFS131A05Sequence614003955 (5)gb:BT006177_16390697e-55Arabidopsis thaliana clone RAFL15-48-I15 (R20938) unknown protein (At3g20720) mR
JMSF008E16Sequence310003955 (5)gb:BT006177_16390694e-23Arabidopsis thaliana clone RAFL15-48-I15 (R20938) unknown protein (At3g20720) mR765003355 (3)gb:BT006177_16390691e-37Arabidopsis thaliana clone RAFL15-48-I15 (R20938) unknown protein (At3g20720) mR
JMSF030P18Sequence581003955 (5)gb:BT006177_16390696e-55Arabidopsis thaliana clone RAFL15-48-I15 (R20938) unknown protein (At3g20720) mR764003355 (3)gb:BT006177_16390694e-38Arabidopsis thaliana clone RAFL15-48-I15 (R20938) unknown protein (At3g20720) mR

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS055E04+ GTCCTTTGGATGGTGATATTCGCCTCTCCTGATATTCCTTCAACAA
                      ____________________________________________________________
consensus GTCCTTTGGATGGTGATATTCGCCTCTCCTGATATTCCTTCAACAA
 
. : . : . : . : . : . :
JMFS055E04+ ATCTCTCTCCACCAAAAAATACGCGTTTCGCTCCATCTTCATCTTTCCTATTAGATCCCC
                      ____________________________________________________________
consensus ATCTCTCTCCACCAAAAAATACGCGTTTCGCTCCATCTTCATCTTTCCTATTAGATCCCC
 
. : . : . : . : . : . :
JMFS055E04+ CATGGGAAGAACCAAAATGAGCATCCGAGAACATATCAGGATGTGGTAACAGGTCAATTG
                      ____________________________________________________________
consensus CATGGGAAGAACCAAAATGAGCATCCGAGAACATATCAGGATGTGGTAACAGGTCAATTG
 
. : . : . : . : . : . :
JMFS055E04+ ACAGATATTCCCATTTCAGTTGCTTGAACACATATATGAAGTTCTTGTTATTGGAGAAGT
                      ____________________________________________________________
consensus ACAGATATTCCCATTTCAGTTGCTTGAACACATATATGAAGTTCTTGTTATTGGAGAAGT
 
. : . : . : . : . : . :
JMFS055E04+ CCCTGGCTTCCTTGAGATTTACCACCTGCCAGTTCTCGTTTGTAGTATATAGCAGAAGGT
JMFS063B09+ TGAGATTTACCACCTGCCAGTTCTCGTTTGTAGTATATAGCAGAAGGT
                      ____________________________________________________________
consensus CCCTGGCTTCCTTGAGATTTACCACCTGCCAGTTCTCGTTTGTAGTATATAGCAGAAGGT
 
. : . : . : . : . : . :
JMFS055E04+ TTCTTATGGTAATCGATGCCATAGGTGATGCCCAAGTTGCTCCTCCTCGACGTCGAGCAC
JMFS063B09+ TTCTTATGGTAATCGATGCCATAGGTGATGCCCAAGTTGCTCCTCCTCGACGTCGAGCAC
JMSF030P18+ CGACGTCGAGCAC
JMFS131A05+ CGACGTCGAGCAC
                      ____________________________________________________________
consensus TTCTTATGGTAATCGATGCCATAGGTGATGCCCAAGTTGCTCCTCCTCGACGTCGAGCAC
 
. : . : . : . : . : . :
JMFS055E04+ CACCATGAGTTTCAAGTAGGAGGTTAACTGTACGCACTTCTAGAGTCATTCCATCAGCAA
JMFS063B09+ CACCATGAGTTTCAAGTAGGAGGTTAACTGTACGCACTTCTAGAGTCATTCCATCAGCAA
JMSF030P18+ CACCATGAGTTTCAAGTAGGAGGTTAACTGTACGCACTTCTAGAGTCATTCCATCAGCAA
JMFS131A05+ CACCATGAGTTTCAAGTAGGAGGTTAACTGTACGCACTTCTAGAGTCATTCCATCAGCAA
                      ____________________________________________________________
consensus CACCATGAGTTTCAAGTAGGAGGTTAACTGTACGCACTTCTAGAGTCATTCCATCAGCAA
 
. : . : . : . : . : . :
JMFS055E04+ TCTTGTCGGCTAAACCATAGCCACTGCTCTTCGTGGAGCTAGTGAATGATGAAGCACTGC
JMFS063B09+ TCTTGTCGGCTAAACCATAGCCACTGCTCTTCGTGGAGCTAGTGAATGATGAAGCACTGC
JMSF030P18+ TCTTGTCGGCTAAACCATAGCCACTGCTCTTCGTGGAGCTAGTGAATGATGAAGCACTGC
JMFS131A05+ TCTTGTCGGCTAAACCATAGCCACTGCTCTTCGTGGAGCTAGTGAATGATGAAGCACTGC
                      ____________________________________________________________
consensus TCTTGTCGGCTAAACCATAGCCACTGCTCTTCGTGGAGCTAGTGAATGATGAAGCACTGC
 
. : . : . : . : . : . :
JMFS055E04+ TAGGGCTCTTCTGTTCATCAACATCATCATTCTCCTCCAGAACAATATCAAGCCTATCAA
JMFS063B09+ TAGGGCTCTTCTGTTCATCAACATCATCATTCTCCTCCAGAACAATATCAAGCCTATCAA
JMSF030P18+ TAGGGCTCTTCTGTTCATCAACATCATCATTCTCCTCCAGAACAATATCAAGCCTATCAA
JMFS131A05+ TAGGGCTCTTCTGTTCATCAACATCATCATTCTCCTCCAGAACAATATCAAGCCTATCAA
                      ____________________________________________________________
consensus TAGGGCTCTTCTGTTCATCAACATCATCATTCTCCTCCAGAACAATATCAAGCCTATCAA
 
. : . : . : . : . : . :
JMFS055E04+ TTTGGACGACTATTGGCTCTATTTGCACATTGCTTACTGATGGAAGAATAATCTCCAATT
JMFS063B09+ TTTGGACGACTATTGGCTCTATTTGCACATTGCTTACTGATGGAAGAATAATCTCCAATT
JMSF030P18+ TTTGGACGACTATTGGCTCTATTTGCACATTGCTTACTGATGGAAGAATAATCTCCAATT
JMFS131A05+ TTTGGACGACTATTGGCTCTATTTGCACATTGCTTACTGATGGAAGAATAATCTCCAATT
                      ____________________________________________________________
consensus TTTGGACGACTATTGGCTCTATTTGCACATTGCTTACTGATGGAAGAATAATCTCCAATT
 
. : . : . : . : . : . :
JMFS055E04+ TTCCGACTTTTGCAGTGGTAACATTCAGTGCCGGCGGTAGC
JMFS063B09+ TTCCGACTTTTGCAGTGGTAACATTCAGTGCCGGCGGTAGCCCCACACTAGCATGCAAAG
JMSF030P18+ TTCCGACTTTTGCAGTGGTAACATTCAGTGCCGGCGGTAGCCCCACACTAGCATGCAAAG
JMSF008E16+ GGTAACATTCAGTGCCGGCGGTAGCCCCACACTAGCATGCAAAG
JMFS131A05+ TTCCGACTTTTGCAGTGGTAACATTCAGTGCCGGCGGTAGCCCCACACTAGCATGCAAAG
                      ____________________________________________________________
consensus TTCCGACTTTTGCAGTGGTAACATTCAGTGCCGGCGGTAGCCCCACACTAGCATGCAAAG
 
. : . : . : . : . : . :
JMFS063B09+ CATCTCCATTTATATCTAAATTAGAAAGCTGCGCGGTGCGCCCCTGCAACTTAAACTGAT
JMSF030P18+ CATCTCCATTTATATCTAAATTAGAAAGCTGCGCGGTGCGCCCCTGCAACTTAAACTGAT
JMSF008E16+ CATCTCCATTTATATCTAAATTAGAAAGCTGCGCGGTGCGCCCCTGCAACTTAAACTGAT
JMFS131A05+ CATCTCCATTTATATCTAAATTAGAAAGCTGCGCGGTGCGCCCCTGCAACTTAAACTGAT
                      ____________________________________________________________
consensus CATCTCCATTTATATCTAAATTAGAAAGCTGCGCGGTGCGCCCCTGCAACTTAAACTGAT
 
. : . : . : . : . : . :
JMFS063B09+ CTCTACTGAACGACTTGAGCCAATACTTGAGCGTGTACTCCAGAGCTCGCGCTATTATAG
JMSF030P18+ CTCTACTGAACGACTTGAGCCAATACTTGAGCGTGTACTCCAGAGCTCGCGCTATTATAG
JMSF008E16+ CTCTACTGAACGACTTGAGCCAATACTTGAGCGTGTACTCCAGAGCTCGCGCTATTATAG
JMFS131A05+ CTCTACTGAACGACTTGAGCCAATACTTGAGCGTGTACTCCAGAGCTCGCGCTATTATAG
                      ____________________________________________________________
consensus CTCTACTGAACGACTTGAGCCAATACTTGAGCGTGTACTCCAGAGCTCGCGCTATTATAG
 
. : . : . : . : . : . :
JMFS063B09+ ACTCCATCTCCGAACTCTGACCTCCCAGAAGCTCCCTGGAGACGAAAAAGTAGACAATTC
JMSF030P18+ ACTCCATCTCCGAACTCTGACCTCCCAGAAGCTCCCTGGAGACGAAAAAGTAGACAATTC
JMSF008E16+ ACTCCATCCCCGAACTCTGACCTCCCAGAAGCTCCCTGGAGACGAAAAAGTAGACAATTC
JMFS131A05+ ACTCCATCTCCGAACTCTGACCTCCCAGAAGCTCCCTGGAGACGAAAAAGTAGACAATTC
                      ____________________________________________________________
consensus ACTCCATCTCCGAACTCTGACCTCCCAGAAGCTCCCTGGAGACGAAAAAGTAGACAATTC
 
. : . : . : . : . : . :
JMFS063B09+ TGCAATTCAGTAGATCTAGAAACCACCAGGAAGGAAGCAACGCTCTAGACGGAG
JMSF030P18+ TGCAATTCAGTAGATCTAGAAACCACCAGGAAGGAAGCAACGCTCTAGACGGAGAAGGAT
JMSF008E16+ TGCAATTCAGTAGATCTAGAAACCACCAGGAAGGAAGCAACGCTCTAGACGGAGAAGGAT
JMFS131A05+ TGCAATTCAGTAGATCTAGAAACCACCAGGAAGGAAGCAACGCTCTAGACGGAGAAGGAT
                      ____________________________________________________________
consensus TGCAATTCAGTAGATCTAGAAACCACCAGGAAGGAAGCAACGCTCTAGACGGAGAAGGAT
 
. : . : . : . : . : . :
JMSF030P18+ GCGGTGGAGCATCAGATCGGGTAC
JMSF008E16+ GCGGTGGAGCATCAGATCGGGTAC
JMFS131A05+ GCGGTGGAGCATCAGATCGGGTACGGTGAAGATCGGAGCCGGAGCGGAAGGTTAATTTGG
                      ____________________________________________________________
consensus GCGGTGGAGCATCAGATCGGGTACGGTGAAGATCGGAGCCGGAGCGGAAGGTTAATTTGG